Advertisements
Advertisements
Question
Describe the process of semiconservative replication of DNA with the help of a neat and labelled diagram.
Advertisements
Solution
The process by which DNA duplicates to form identical copies is known as replication.
Semi-conservative method of replication:
- After replication, each daughter DNA molecule has one old and other new strands.
- As parental DNA is partly conserved in each daughter DNA, the process of replication is called semi-conservative.
Mechanism of replication is as follows:
- Activation of Nucleotides:
1. The four types of nucleotides of DNA i.e. dAMP, dGMP, dCMP, and dTMP are present in the nucleoplasm.
2. They are activated by ATP in presence of an enzyme phosphorylase.
3. This results in the formation of deoxyribonucleotide triphosphates i.e. dATP, dGTP, dCTP, and dTTP. This process is known as Phosphorylation. - Point of Origin or Initiation point:
1. Replication begins at a specific point ‘O’ origin and terminates at point ‘T’.
2. Origin is flanked by ‘T’ sites. The unit of DNA in which replication occurs is called a replicon.
3. In prokaryotes, there is only one replicon however in eukaryotes, there are several replicons in tandem.
4. At the point ‘O’, enzyme endonuclease nicks one of the strands of DNA, temporarily.
5. The nick occurs in the sugar-phosphate backbone or the phosphodiester bond. - Unwinding of DNA molecule:
1. Enzyme DNA helicase breaks weak hydrogen bonds in the vicinity of ‘O’.
2. The strands of DNA separate and unwind. This unwinding is bidirectional and continues as a ‘Y’ shaped replication fork.
3. Each separated strand acts as a template.
4. The two separated strands are prevented from recoiling (re-joining) by SSBP (Single-strand binding proteins).
5. SSB proteins remain attached to both the separated strands for facilitating the synthesis of new polynucleotide strands. - Replicating fork:
1. The point formed due to the unwinding and separation of two strands appears like a Y-shaped fork, called replicating/ replication fork.
2. The unwinding of strands imposes strain which is relieved by the super-helix relaxing enzyme. - Synthesis of new strands:
1. Each separated strand acts as a mould or template for the synthesis of the new complementary strand.
2. It requires a small RNA molecule, called an RNA primer.
3. RNA primer attaches to the 3’ end of the template strand and attracts complementary nucleotides from the surrounding nucleoplasm.
4. These nucleotides bind to the complementary nucleotides on the template strand by forming hydrogen bonds (i.e. A=T or T=A; G = C or C = G).
5. The newly bound consecutive nucleotides get interconnected by phosphodiester bonds, forming a polynucleotide strand.
6. The synthesis of a new complementary strand is catalysed by the enzyme DNA polymerase.
7. The new complementary strand is always formed in the 5’ → 3’ direction. - Leading and Lagging strand:
1. The template strand with a free 3’ end is called a leading template and with a free 5’ end is called a lagging template.
2. The process of replication always starts at the C-3 end of the template strand and proceeds towards the C-5 end.
3. As both the strands of the parental DNA are antiparallel, new strands are always formed in the 5’ → 3’ direction.
4. One of the newly synthesized strands which develop continuously towards replicating the fork is called the leading strand.
5. Another new strand develops discontinuously away from the replicating fork and is called a lagging strand.
6. Maturation of Okazaki fragments: DNA synthesis on lagging template takes place in the form of small fragments called Okazaki fragments (named after scientist Okazaki).
7. Okazaki fragments are joined by enzyme DNA ligase.
8. RNA primers are removed by DNA polymerase and replaced by DNA sequence with the help of DNA polymerase-I in prokaryotes and DNA polymerase-α in eukaryotes.
9. Finally, the DNA gyrase (topoisomerase) enzyme forms a double helix to form daughter DNA molecules. - Formation of daughter DNA molecules:
1. At the end of the replication, two daughter DNA molecules are formed.
2. In each daughter DNA, one strand is parental and the other one is totally newly synthesized.
3. Thus, 50% is contributed by mother DNA. Hence, it is described as semiconservative replication.

APPEARS IN
RELATED QUESTIONS
What is the function of an RNA primer during protein synthesis?
Which enzyme does remove supercoils from replicating DNA?
Draw neat and labelled diagram of Replication Fork.
How Meselson and Stahl explained the concept of Semiconservative Replication of DNA experimentally?
E. coli cell grown on 15N medium are transferred to 14N medium and allowed to grow for two generations. DNA extracted from these cells is ultracentrifuged in a cesium chloride density gradient. What density distribution of DNA would you expect in this experiment?
Meselson and Stahl used ____________ in the experiment to prove semiconservative DNA replication.
In which direction polymerization of DNA nucleotides occurs during the synthesis of lagging strand?
Identify the CORRECT combination of statements with respect to DNA synthesis.
I. Always the direction of DNA polymerization 5' → 3' when referring to the polarity of strand being synthesized.
II. DNA ligase forms hydrogen bonds between two newly synthesized DNA strands.
III. DNA polymerases on their own cannot initiate the process of replication.
IV. DNA polymerase can catalyse polymerization in both 5'→ 3' and 3'→ 5' direction.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
Statement I - In prokaryotes, there is only replicon however in eukaryotes, these are several replicons in tandem.
Statement II - Two separated strands in a replicon of DNA are prevented from re-joining by helicase enzyme.
In light of above statements, choose the correct answer from the option given below.
