हिंदी

Differentiate between Leading stand and lagging strand.

Advertisements
Advertisements

प्रश्न

Differentiate between Leading stand and lagging strand.

अंतर स्पष्ट करें
Advertisements

उत्तर

Feature Leading Strand Lagging Strand
1. Direction of synthesis Synthesized continuously in the same direction as the replication fork. Synthesized discontinuously in the opposite direction of the replication fork.
2. Formation Formed as a single, continuous strand. Formed in short fragments called Okazaki fragments.
3. Requirement of primers Requires only one RNA primer to start synthesis. Requires multiple RNA primers, one for each Okazaki fragment.
4. DNA polymerase movement Moves toward the replication fork. Moves away from the replication fork.
5. Speed of synthesis Faster because it is continuous. Slower because it is discontinuous.
shaalaa.com
  क्या इस प्रश्न या उत्तर में कोई त्रुटि है?
अध्याय 5: Molecular Genetics - Evaluation [पृष्ठ ८५]

APPEARS IN

सामाचीर कलवी Biology (Zoology) [English] Class 12 TN Board
अध्याय 5 Molecular Genetics
Evaluation | Q 17. | पृष्ठ ८५
सामाचीर कलवी Biology (Zoology) [English] Class 12 TN Board
अध्याय 5 Molecular Genetics
Evaluation | Q 17. | पृष्ठ ८८
नूतन Biology [English] Class 12 ISC
अध्याय 5 Molecular Basis of Inheritance
DIFFERENTIATE BETWEEN | Q 5. | पृष्ठ २७९

संबंधित प्रश्न

What is the correct sequence of the stages in bacteriophage lytic cycle?

(A) Attachment, Penetration, Lysis, Multiplication

(B) Attachment, Penetration, Multiplication, Lysis

(C) Lysis, Penetration, Multiplication, Attachment

(D) Attachment, Lysis, Multiplication, Penetration


Explain the semi-conservative replication of eukaryotic DNA.


What is Bacteriophage?


What is the function of SSBP?


Draw neat and labelled diagram of Replication Fork.


How Meselson and Stahl explained the concept of Semiconservative Replication of DNA experimentally?


a) Identify the figure given below

b) Redraw the structure as a replicating fork and label the parts


c) Write the source of energy for this replication and name the enzyme involved in this process.

d) Mention the differences in the synthesis of protein, based on the polarity of the two template strands.


Which of the following is the function of single-strand binding proteins?


Which of tbe following is generally used for creating density gradient during centrifugation?


______ carbon atoms of successive nucleotides of nucleic acid are linked by Phospho-diester bond.


In a segment of DNA with 10 base pairs, the numbers of sugar molecules are _________.


Select the mis-matched pair.


During replication of DNA Okazaki fragments are formed in the direction:


Okazaki segments are formed during ______.


In the experiment of Meselson and Stahl, the heavy DNA was separated from light DNA by centrifugation in ______.


How many amino acids will be there in the polypeptide chain formed on the following mRNA?

5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'


In prokaryotes, the primers of lagging strands are removed by ______.


The sequence of nitrogenous bases on DNA molecule is ATCGA. Which of the following is the correct complementary sequence of nitrogenous bases on mRNA molecule?


Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×