हिंदी

Differentiate between Leading stand and lagging strand. - Biology (Theory)

Advertisements
Advertisements

प्रश्न

Differentiate between Leading stand and lagging strand.

अंतर स्पष्ट करें
Advertisements

उत्तर

Feature Leading Strand Lagging Strand
1. Direction of synthesis Synthesized continuously in the same direction as the replication fork. Synthesized discontinuously in the opposite direction of the replication fork.
2. Formation Formed as a single, continuous strand. Formed in short fragments called Okazaki fragments.
3. Requirement of primers Requires only one RNA primer to start synthesis. Requires multiple RNA primers, one for each Okazaki fragment.
4. DNA polymerase movement Moves toward the replication fork. Moves away from the replication fork.
5. Speed of synthesis Faster because it is continuous. Slower because it is discontinuous.
shaalaa.com
  क्या इस प्रश्न या उत्तर में कोई त्रुटि है?
अध्याय 5: Molecular Genetics - Evaluation [पृष्ठ ८५]

APPEARS IN

सामाचीर कलवी Biology (Zoology) [English] Class 12 TN Board
अध्याय 5 Molecular Genetics
Evaluation | Q 17. | पृष्ठ ८५
सामाचीर कलवी Biology (Zoology) [English] Class 12 TN Board
अध्याय 5 Molecular Genetics
Evaluation | Q 17. | पृष्ठ ८८
नूतन Biology [English] Class 12 ISC
अध्याय 6 Molecular Basis of Inheritance
DIFFERENTIATE BETWEEN | Q 5. | पृष्ठ २७९

संबंधित प्रश्न

Explain the semi-conservative replication of eukaryotic DNA.


______ heavy isotope was used by Meselson and Stahl during their experiment.


When DNA directs the synthesis of chemical molecules other than itself, then such functions of DNA are known as ______.


Which one of the following correctly represents the manner of replication of DNA?


Which of the following represents the autocatalytic functions of DNA?


At the point of origin, enzyme endonuclease nicks one of the strands of DNA by breaking the ______


For which of the following reason RNA primer is must for initiation of DNA replication?


Which of the following is present at the sticky ends of a fragmented DNA molecule?


Which one of the following can form a nucleotide of DNA?


______ carbon atoms of successive nucleotides of nucleic acid are linked by Phospho-diester bond.


Which of the following statement is incorrect?


Wobble position means:


Okazaki segments are formed during ______.


What background information did Watson and Crick had available with them for developing a model of DNA? What was their own contribution?


The nucleic acid synthesis takes place in ______.


In the experiment of Meselson and Stahl, the heavy DNA was separated from light DNA by centrifugation in ______.


Select the incorrect statement regarding DNA replication.


How many amino acids will be there in the polypeptide chain formed on the following mRNA?

5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'


Torsional stress created during DNA replication is relieved by ______.


Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×