Advertisements
Advertisements
प्रश्न
Name the parts marked ‘A’ and ‘B’ in the given transcription unit:
Advertisements
उत्तर
(A) - Promoter site
(B) - Structural gene
संबंधित प्रश्न
Following are the features of genetic codes. What does each one indicate?
Stop codon; Unambiguous codon; Degenerate codon; Universal codon.
- Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides.
- Explain the basis on which he arrived at this conclusion.
Name the enzyme responsible for the transcription of tRNA and the amino acid the initiator tRNA gets linked with.
Explain the role of initiator tRNA in the initiation of protein synthesis.
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
Which is not involved in protein synthesis?
The process of copying genetic information from one strand of DNA to RNA is termed as ______.
What is the direction of the template strand during transcription?
How many stages does transcription occur in?
In eukaryotes, what is the name of the primary RNA product immediately after transcription?
