Advertisements
Advertisements
प्रश्न
Name the parts marked ‘A’ and ‘B’ in the given transcription unit:
Advertisements
उत्तर
(A) - Promoter site
(B) - Structural gene
संबंधित प्रश्न
Name the enzyme responsible for the transcription of tRNA and the amino acid the initiator tRNA gets linked with.
Explain the role of initiator tRNA in the initiation of protein synthesis.
What is the central dogma?
Explain the mechanism of transcription in a prokaryotic cell.
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
The process of transfer of genetic information from DNA to RNA/formation of RNA from DNA is ______.
Reverse transcriptase is ______.
In a cell, DNA transcription is halted when ______
Read the following and answer from given below:
The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.
Which ion is essential for the association of both units of the ribosome at the time of protein formation?
The process of copying genetic information from one strand of the DNA into RNA is termed as ______
