Advertisements
Advertisements
प्रश्न
Give reasons:
Genetic code is ‘universal’.
Explain when is a genetic code said to be universal.
Advertisements
उत्तर
The genetic code is universal. It means that all known living systems use nucleic acids and the same three base codons (triplet codon) direct the synthesis of protein from amino acids. For example, the mRNA (UUU) codon codes for phenylalanine in all cells of all organisms. Some exceptions are reported in prokaryotic, mitochondrial and chloroplast genomes. However, similarities are more common than differences.
APPEARS IN
संबंधित प्रश्न
Write the contributions of the following scientists in deciphering the genetic code.
George Gamow; Hargobind Khorana; Marshall Nirenberg; Severo Ochoa
Differentiate between the genetic codes given below:
Unambiguous and Universal
Name the anticodon required to recognize the following codon: UAU
One of the following is true with respect to AUG.
Khorana first deciphered the triplet codons of ______.
Because most of the amino acids are represented by more than one codon, the genetic code is ______.
Out of A=T, G =C pairing, bases of DNA may exist in alternate valency state owing to arrangement called ______.
H. J. Muller was awarded Nobel Prize for his ______.
Amino acids which are specified by single codons are ______.
If the sequence of bases in coding strand of DNA is ATTCGATG, then the sequence of bases in mRNA will be ______.
Which of the following organ is essential for photorespiration?
Percentage of mitochondrial DNA in the cell is:
Genetic code was discovered by:
What would happen if in a gene encoding a polypeptide of so amino acid 25th (UAC) is match to UAA?
George Gamow suggested that each codon coding for an amino acid consists of ______
Which amino acid is determined by four genetic codes?
Frame shift mutations are caused by ______.
Statement I:
The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II:
‘AAA’ and ‘AAG’ are both codons that code for the amino acid lysine.
In light of the above statements, choose the correct answer from the options given below.
Based on your understanding of genetic code, explain the formation of any abnormal hemoglobin molecule. What are the known consequences of such a change?
Discuss the process of translation in detail.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
How many codons in total exist in the genetic code?
Which of the following statements about stop codons is correct?
Which scientist proved the triplet nature of the genetic code through frame-shift mutation experiments in 1961?
Which scientist developed a method for synthesizing RNA molecules with repeated known nucleotide sequences to help decipher the genetic code?
How many codons code for amino acids and how many are stop codons?
