Advertisements
Advertisements
Questions
Give reasons:
Genetic code is ‘universal’.
Explain when is a genetic code said to be universal.
Advertisements
Solution
The genetic code is universal. It means that all known living systems use nucleic acids and the same three base codons (triplet codon) direct the synthesis of protein from amino acids. For example, the mRNA (UUU) codon codes for phenylalanine in all cells of all organisms. Some exceptions are reported in prokaryotic, mitochondrial and chloroplast genomes. However, similarities are more common than differences.
APPEARS IN
RELATED QUESTIONS
Name the anticodon required to recognize the following codon: AAU.
Name the anticodon required to recognize the following codon: UAU
DNA is a polymer of nucleotides which are linked to each other by 3’-5’ phosphodiester bond. To prevent polymerisation of nucleotides, which of the following modifications would you choose?
Out of A=T, G =C pairing, bases of DNA may exist in alternate valency state owing to arrangement called ______.
H. J. Muller was awarded Nobel Prize for his ______.
Amino acids which are specified by single codons are ______.
Which out of the following statements is incorrect?
Some amino acids are coded by more than one codon, hence the genetic code is ______.
Select the incorrectly matched pair.
Which of the following organ is essential for photorespiration?
Percentage of mitochondrial DNA in the cell is:
Genetic code translates the language of:
Methionine carrying tRNA has anticodon:
Genetic code was discovered by:
George Gamow suggested that each codon coding for an amino acid consists of ______
How many codons code for amino acid?
Based on your understanding of genetic code, explain the formation of any abnormal hemoglobin molecule. What are the known consequences of such a change?
A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct? Defend your answer.
Discuss the process of translation in detail.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
According to George Gamow's proposal from 1954, why is the genetic code a triplet code?
Which of the following statements about stop codons is correct?
What is the start codon and which amino acid does it code for?
