Advertisements
Advertisements
Questions
Give reasons:
Genetic code is ‘universal’.
Explain when is a genetic code said to be universal.
Advertisements
Solution
The genetic code is universal. It means that all known living systems use nucleic acids and the same three base codons (triplet codon) direct the synthesis of protein from amino acids. For example, the mRNA (UUU) codon codes for phenylalanine in all cells of all organisms. Some exceptions are reported in prokaryotic, mitochondrial and chloroplast genomes. However, similarities are more common than differences.
APPEARS IN
RELATED QUESTIONS
The first codon to be deciphered was ______ which codes for ______.
Name the anticodon required to recognize the following codon: AAU.
Name the anticodon required to recognize the following codon: CGA
Name the anticodon required to recognize the following codon: UAU
One of the following is true with respect to AUG.
DNA is a polymer of nucleotides which are linked to each other by 3’-5’ phosphodiester bond. To prevent polymerisation of nucleotides, which of the following modifications would you choose?
Frame shift mutation occurs when ______.
Because most of the amino acids are represented by more than one codon, the genetic code is ______.
The number of base substitution possible in amino acid codons is ______.
Out of A=T, G =C pairing, bases of DNA may exist in alternate valency state owing to arrangement called ______.
Which out of the following statements is incorrect?
The mutations that involve addition, deletion or substitution of a single pair in a gene are referred to as ______.
Sickle cell anemia results from a single base substitution in a gene, thus it is an example of ______.
Select the incorrectly matched pair.
Phenylalanine is a ______.
What would happen if in a gene encoding a polypeptide of so amino acid 25th (UAC) is match to UAA?
Which amino acid is determined by four genetic codes?
How many codons code for amino acid?
Statement I: The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II: ‘AAA’ and ‘AAG’ both codons code for the amino acid lysine.
In the light of the above statements, choose the correct answer from the options given below.
Statement I:
The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II:
‘AAA’ and ‘AAG’ are both codons that code for the amino acid lysine.
In light of the above statements, choose the correct answer from the options given below.
Which of the following statements is the most appropriate for sickle cell anaemia?
A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct? Defend your answer.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
All the 64 codons in the dictionary of genetic code were deciphered by ______.
