Advertisements
Advertisements
प्रश्न
Give reasons:
Genetic code is ‘universal’.
Explain when is a genetic code said to be universal.
Advertisements
उत्तर
The genetic code is universal. It means that all known living systems use nucleic acids and the same three base codons (triplet codon) direct the synthesis of protein from amino acids. For example, the mRNA (UUU) codon codes for phenylalanine in all cells of all organisms. Some exceptions are reported in prokaryotic, mitochondrial and chloroplast genomes. However, similarities are more common than differences.
APPEARS IN
संबंधित प्रश्न
Give an example of a codon having a dual function.
Write the contributions of the following scientists in deciphering the genetic code.
George Gamow; Hargobind Khorana; Marshall Nirenberg; Severo Ochoa
Differentiate between the genetic codes given below:
Degenerate and Initiator
Name the anticodon required to recognize the following codon: GCA.
DNA is a polymer of nucleotides which are linked to each other by 3’-5’ phosphodiester bond. To prevent polymerisation of nucleotides, which of the following modifications would you choose?
Genetic code is ______.
Out of A=T, G =C pairing, bases of DNA may exist in alternate valency state owing to arrangement called ______.
The change of the light coloured variety of peppered moth (Biston betularia) to its darker variety (Biston carbonarid) is due to ______.
H. J. Muller was awarded Nobel Prize for his ______.
Amino acids which are specified by single codons are ______.
The mutations that involve addition, deletion or substitution of a single pair in a gene are referred to as ______.
Select the incorrectly matched pair.
If the sequence of bases in coding strand of DNA is ATTCGATG, then the sequence of bases in mRNA will be ______.
AUG on the mRNA will result in the activation of which of the following RNA having the correct combination of amino acids:
| Site A | Site B | |
| A. | UAC | Methionine |
| B. | Methionine | UAC |
| C. | Methionine | AUG |
| D. | AUG | Methionine |
Which of the following organ is essential for photorespiration?
Phenylalanine is a ______.
Genetic code is universal, it means ______
Which amino acid is determined by four genetic codes?
How many codons code for amino acid?
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
Who proposed that the genetic code for amino acids should be made up of three nucleotides?
