Advertisements
Advertisements
प्रश्न
Give reasons:
Genetic code is ‘universal’.
Explain when is a genetic code said to be universal.
Advertisements
उत्तर
The genetic code is universal. It means that all known living systems use nucleic acids and the same three base codons (triplet codon) direct the synthesis of protein from amino acids. For example, the mRNA (UUU) codon codes for phenylalanine in all cells of all organisms. Some exceptions are reported in prokaryotic, mitochondrial and chloroplast genomes. However, similarities are more common than differences.
APPEARS IN
संबंधित प्रश्न
Differentiate between the genetic codes given below:
Unambiguous and Universal
Differentiate between the genetic codes given below:
Degenerate and Initiator
The first codon to be deciphered was __________ which codes for ________.
Genetic code is ______.
Frame shift mutation occurs when ______.
The number of base substitution possible in amino acid codons is ______.
Out of A=T, G =C pairing, bases of DNA may exist in alternate valency state owing to arrangement called ______.
The change of the light coloured variety of peppered moth (Biston betularia) to its darker variety (Biston carbonarid) is due to ______.
The mutations that involve addition, deletion or substitution of a single pair in a gene are referred to as ______.
Sickle cell anemia results from a single base substitution in a gene, thus it is an example of ______.
Genetic code translates the language of:
Methionine carrying tRNA has anticodon:
Genetic code was discovered by:
Statement I:
The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II:
‘AAA’ and ‘AAG’ are both codons that code for the amino acid lysine.
In light of the above statements, choose the correct answer from the options given below.
Based on your understanding of genetic code, explain the formation of any abnormal hemoglobin molecule. What are the known consequences of such a change?
There is only one possible sequence of amino acids when deduced from a given nucleotides. But multiple nucleotides sequence can be deduced from a single amino acid sequence. Explain this phenomena.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
