Advertisements
Advertisements
प्रश्न
Give reasons:
Genetic code is ‘universal’.
Explain when is a genetic code said to be universal.
Advertisements
उत्तर
The genetic code is universal. It means that all known living systems use nucleic acids and the same three base codons (triplet codon) direct the synthesis of protein from amino acids. For example, the mRNA (UUU) codon codes for phenylalanine in all cells of all organisms. Some exceptions are reported in prokaryotic, mitochondrial and chloroplast genomes. However, similarities are more common than differences.
APPEARS IN
संबंधित प्रश्न
Differentiate between the genetic codes given below:
Unambiguous and Universal
Name the anticodon required to recognize the following codon: CGA
Name the anticodon required to recognize the following codon: GCA.
Genetic code is ______.
Frame shift mutation occurs when ______.
Because most of the amino acids are represented by more than one codon, the genetic code is ______.
H. J. Muller was awarded Nobel Prize for his ______.
Amino acids which are specified by single codons are ______.
Which out of the following statements is incorrect?
Some amino acids are coded by more than one codon, hence the genetic code is ______.
The mutations that involve addition, deletion or substitution of a single pair in a gene are referred to as ______.
Select the incorrectly matched pair.

AUG on the mRNA will result in the activation of which of the following RNA having the correct combination of amino acids:
| Site A | Site B | |
| A. | UAC | Methionine |
| B. | Methionine | UAC |
| C. | Methionine | AUG |
| D. | AUG | Methionine |
Which of the following organ is essential for photorespiration?
Genetic code was discovered by:
What would happen if in a gene encoding a polypeptide of so amino acid 25th (UAC) is match to UAA?
Frame shift mutations are caused by ______.
Which of the following statements is the most appropriate for sickle cell anaemia?
Based on your understanding of genetic code, explain the formation of any abnormal hemoglobin molecule. What are the known consequences of such a change?
A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct? Defend your answer.
There is only one possible sequence of amino acids when deduced from a given nucleotides. But multiple nucleotides sequence can be deduced from a single amino acid sequence. Explain this phenomena.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
Who proposed that the genetic code for amino acids should be made up of three nucleotides?
