Advertisements
Advertisements
प्रश्न
DNA is a polymer of nucleotides which are linked to each other by 3’-5’ phosphodiester bond. To prevent polymerisation of nucleotides, which of the following modifications would you choose?
विकल्प
Remove/Replace 3' OH group in deoxy ribose
Remove/Replace 2' OH group with some other group in deoxy ribose
Both ‘B’ and ‘C’
Replace purine with pyrimidines
Advertisements
उत्तर
Remove/Replace 3' OH group in deoxy ribose
APPEARS IN
संबंधित प्रश्न
Give an example of a codon having dual function.
Write the contributions of the following scientists in deciphering the genetic code.
George Gamow; Hargobind Khorana; Marshall Nirenberg; Severo Ochoa
The first codon to be deciphered was __________ which codes for ________.
Give reasons:
Genetic code is ‘universal’.
Name the anticodon required to recognize the following codon: AAU.
Name the anticodon required to recognize the following codon: GCA.
One of the following is true with respect to AUG.
Because most of the amino acids are represented by more than one codon, the genetic code is ______.
The number of base substitution possible in amino acid codons is ______.
Out of A=T, G =C pairing, bases of DNA may exist in alternate valency state owing to arrangement called ______.
The mutations that involve addition, deletion or substitution of a single pair in a gene are referred to as ______.
Select the incorrectly matched pair.
Genetic code is universal, it means ______
Which of the following statements is the most appropriate for sickle cell anaemia?
A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct? Defend your answer.
There is only one possible sequence of amino acids when deduced from a given nucleotides. But multiple nucleotides sequence can be deduced from a single amino acid sequence. Explain this phenomena.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
