Advertisements
Advertisements
प्रश्न
DNA is a polymer of nucleotides which are linked to each other by 3’-5’ phosphodiester bond. To prevent polymerisation of nucleotides, which of the following modifications would you choose?
पर्याय
Remove/Replace 3' OH group in deoxy ribose
Remove/Replace 2' OH group with some other group in deoxy ribose
Both ‘B’ and ‘C’
Replace purine with pyrimidines
Advertisements
उत्तर
Remove/Replace 3' OH group in deoxy ribose
APPEARS IN
संबंधित प्रश्न
Write the contributions of the following scientists in deciphering the genetic code.
George Gamow; Hargobind Khorana; Marshall Nirenberg; Severo Ochoa
Differentiate between the genetic codes given below:
Unambiguous and Universal
Name the anticodon required to recognize the following codon: AAU.
Name the anticodon required to recognize the following codon: GCA.
Frame shift mutation occurs when ______.
Because most of the amino acids are represented by more than one codon, the genetic code is ______.
H. J. Muller was awarded Nobel Prize for his ______.
Amino acids which are specified by single codons are ______.
Some amino acids are coded by more than one codon, hence the genetic code is ______.
If the sequence of bases in coding strand of DNA is ATTCGATG, then the sequence of bases in mRNA will be ______.
AUG on the mRNA will result in the activation of which of the following RNA having the correct combination of amino acids:
| Site A | Site B | |
| A. | UAC | Methionine |
| B. | Methionine | UAC |
| C. | Methionine | AUG |
| D. | AUG | Methionine |
Phenylalanine is a ______.
Percentage of mitochondrial DNA in the cell is:
Which amino acid is determined by four genetic codes?
Statement I:
The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II:
‘AAA’ and ‘AAG’ are both codons that code for the amino acid lysine.
In light of the above statements, choose the correct answer from the options given below.
Based on your understanding of genetic code, explain the formation of any abnormal hemoglobin molecule. What are the known consequences of such a change?
There is only one possible sequence of amino acids when deduced from a given nucleotides. But multiple nucleotides sequence can be deduced from a single amino acid sequence. Explain this phenomena.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
Which one of the following is a termination codon?
