Advertisements
Advertisements
प्रश्न
DNA is a polymer of nucleotides which are linked to each other by 3’-5’ phosphodiester bond. To prevent polymerisation of nucleotides, which of the following modifications would you choose?
पर्याय
Remove/Replace 3' OH group in deoxy ribose
Remove/Replace 2' OH group with some other group in deoxy ribose
Both ‘B’ and ‘C’
Replace purine with pyrimidines
Advertisements
उत्तर
Remove/Replace 3' OH group in deoxy ribose
APPEARS IN
संबंधित प्रश्न
Answer the following question.
State the importance of a Genetic code in protein biosynthesis.
Name the anticodon required to recognize the following codon: AAU.
Name the anticodon required to recognize the following codon: CGA
Name the anticodon required to recognize the following codon: UAU
Frame shift mutation occurs when ______.
The number of base substitution possible in amino acid codons is ______.
Out of A=T, G =C pairing, bases of DNA may exist in alternate valency state owing to arrangement called ______.
H. J. Muller was awarded Nobel Prize for his ______.
Amino acids which are specified by single codons are ______.
Sickle cell anemia results from a single base substitution in a gene, thus it is an example of ______.
Select the incorrectly matched pair.
Genetic code translates the language of:
Genetic code was discovered by:
Genetic code is universal, it means ______
Which amino acid is determined by four genetic codes?
Discuss the process of translation in detail.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
Who proposed that the genetic code for amino acids should be made up of three nucleotides?
All the 64 codons in the dictionary of genetic code were deciphered by ______.
