Advertisements
Advertisements
प्रश्न
Which of the following statements is the most appropriate for sickle cell anaemia?
विकल्प
It cannot be treated with iron supplements
It is a molecular disease
It confers resistance to acquiring malaria
All of the above
Advertisements
उत्तर
All of the above
APPEARS IN
संबंधित प्रश्न
Answer the following question.
State the importance of a Genetic code in protein biosynthesis.
Give reasons:
Genetic code is ‘universal’.
DNA is a polymer of nucleotides which are linked to each other by 3’-5’ phosphodiester bond. To prevent polymerisation of nucleotides, which of the following modifications would you choose?
Khorana first deciphered the triplet codons of ______.
Which out of the following statements is incorrect?
AUG on the mRNA will result in the activation of which of the following RNA having the correct combination of amino acids:
| Site A | Site B | |
| A. | UAC | Methionine |
| B. | Methionine | UAC |
| C. | Methionine | AUG |
| D. | AUG | Methionine |
Phenylalanine is a ______.
Genetic code was discovered by:
George Gamow suggested that each codon coding for an amino acid consists of ______
Which amino acid is determined by four genetic codes?
Statement I:
The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II:
‘AAA’ and ‘AAG’ are both codons that code for the amino acid lysine.
In light of the above statements, choose the correct answer from the options given below.
Based on your understanding of genetic code, explain the formation of any abnormal hemoglobin molecule. What are the known consequences of such a change?
There is only one possible sequence of amino acids when deduced from a given nucleotides. But multiple nucleotides sequence can be deduced from a single amino acid sequence. Explain this phenomena.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
According to George Gamow's proposal from 1954, why is the genetic code a triplet code?
Which of the following statements about stop codons is correct?
Which scientist proved the triplet nature of the genetic code through frame-shift mutation experiments in 1961?
Which three scientists are credited with ultimately deciphering all 64 codons of the genetic code dictionary?
