Advertisements
Advertisements
Question
Which of the following statements is the most appropriate for sickle cell anaemia?
Options
It cannot be treated with iron supplements
It is a molecular disease
It confers resistance to acquiring malaria
All of the above
Advertisements
Solution
All of the above
APPEARS IN
RELATED QUESTIONS
Answer the following question.
State the importance of a Genetic code in protein biosynthesis.
The first codon to be deciphered was ______ which codes for ______.
Give reasons:
Genetic code is ‘universal’.
Name the anticodon required to recognize the following codon: AAU.
Name the anticodon required to recognize the following codon: CGA
One of the following is true with respect to AUG.
Frame shift mutation occurs when ______.
The change of the light coloured variety of peppered moth (Biston betularia) to its darker variety (Biston carbonarid) is due to ______.
Amino acids which are specified by single codons are ______.
Which out of the following statements is incorrect?
If the sequence of bases in coding strand of DNA is ATTCGATG, then the sequence of bases in mRNA will be ______.
Genetic code was discovered by:
What would happen if in a gene encoding a polypeptide of so amino acid 25th (UAC) is match to UAA?
Which amino acid is determined by four genetic codes?
How many codons code for amino acid?
Statement I: The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II: ‘AAA’ and ‘AAG’ both codons code for the amino acid lysine.
In the light of the above statements, choose the correct answer from the options given below.
Statement I:
The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II:
‘AAA’ and ‘AAG’ are both codons that code for the amino acid lysine.
In light of the above statements, choose the correct answer from the options given below.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
