Advertisements
Advertisements
Question
Which of the following statements is the most appropriate for sickle cell anaemia?
Options
It cannot be treated with iron supplements
It is a molecular disease
It confers resistance to acquiring malaria
All of the above
Advertisements
Solution
All of the above
APPEARS IN
RELATED QUESTIONS
Write the contributions of the following scientists in deciphering the genetic code.
George Gamow; Hargobind Khorana; Marshall Nirenberg; Severo Ochoa
Name the anticodon required to recognize the following codon: CGA
Name the anticodon required to recognize the following codon: GCA.
DNA is a polymer of nucleotides which are linked to each other by 3’-5’ phosphodiester bond. To prevent polymerisation of nucleotides, which of the following modifications would you choose?
Frame shift mutation occurs when ______.
Because most of the amino acids are represented by more than one codon, the genetic code is ______.
Amino acids which are specified by single codons are ______.
Which out of the following statements is incorrect?
Some amino acids are coded by more than one codon, hence the genetic code is ______.
The mutations that involve addition, deletion or substitution of a single pair in a gene are referred to as ______.
AUG on the mRNA will result in the activation of which of the following RNA having the correct combination of amino acids:
| Site A | Site B | |
| A. | UAC | Methionine |
| B. | Methionine | UAC |
| C. | Methionine | AUG |
| D. | AUG | Methionine |
Methionine carrying tRNA has anticodon:
Genetic code was discovered by:
How many codons code for amino acid?
Statement I: The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II: ‘AAA’ and ‘AAG’ both codons code for the amino acid lysine.
In the light of the above statements, choose the correct answer from the options given below.
Discuss the process of translation in detail.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
Which one of the following is a termination codon?
