Advertisements
Advertisements
Question
Answer the following question.
State the importance of a Genetic code in protein biosynthesis.
Advertisements
Solution
The genetic code is a set of three different nucleotides taken at a time that code for a specific amino acid.
- A codon is a triplet. 3 4 = 64 (61 codons code for amino acids while 3 are stop codons)
- One codon codes for a single specific amino acid. Codons are unambiguous.
- Codons are degenerate since some amino acids are coded by more than one codon.
- The genetic code is universal. 1 codon codes for the same amino acid in all species.
- Codons are read continuously. They lack punctuation.
- AUG has dual functions - Codes for Methionine and acts as a start codon
RELATED QUESTIONS
Differentiate between the genetic codes given below:
Degenerate and Initiator
One of the following is true with respect to AUG.
DNA is a polymer of nucleotides which are linked to each other by 3’-5’ phosphodiester bond. To prevent polymerisation of nucleotides, which of the following modifications would you choose?
Genetic code is ______.
The number of base substitution possible in amino acid codons is ______.
Sickle cell anemia results from a single base substitution in a gene, thus it is an example of ______.
If the sequence of bases in coding strand of DNA is ATTCGATG, then the sequence of bases in mRNA will be ______.
Which of the following organ is essential for photorespiration?
Methionine carrying tRNA has anticodon:
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
