Advertisements
Advertisements
प्रश्न
Which of the following statements is the most appropriate for sickle cell anaemia?
पर्याय
It cannot be treated with iron supplements
It is a molecular disease
It confers resistance to acquiring malaria
All of the above
Advertisements
उत्तर
All of the above
APPEARS IN
संबंधित प्रश्न
Frame shift mutation occurs when ______.
Because most of the amino acids are represented by more than one codon, the genetic code is ______.
The number of base substitution possible in amino acid codons is ______.
H. J. Muller was awarded Nobel Prize for his ______.
Amino acids which are specified by single codons are ______.
Some amino acids are coded by more than one codon, hence the genetic code is ______.
Sickle cell anemia results from a single base substitution in a gene, thus it is an example of ______.
AUG on the mRNA will result in the activation of which of the following RNA having the correct combination of amino acids:
| Site A | Site B | |
| A. | UAC | Methionine |
| B. | Methionine | UAC |
| C. | Methionine | AUG |
| D. | AUG | Methionine |
Phenylalanine is a ______.
Genetic code was discovered by:
What would happen if in a gene encoding a polypeptide of so amino acid 25th (UAC) is match to UAA?
Which amino acid is determined by four genetic codes?
Statement I:
The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II:
‘AAA’ and ‘AAG’ are both codons that code for the amino acid lysine.
In light of the above statements, choose the correct answer from the options given below.
There is only one possible sequence of amino acids when deduced from a given nucleotides. But multiple nucleotides sequence can be deduced from a single amino acid sequence. Explain this phenomena.
Discuss the process of translation in detail.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
