Advertisements
Advertisements
प्रश्न
Give an example of a codon having a dual function.
Advertisements
उत्तर
AUG performs a dual function. It codes for methionine (Met) and works as an initiator codon.
संबंधित प्रश्न
Differentiate between the genetic codes given below:
Unambiguous and Universal
Name the anticodon required to recognize the following codon: UAU
One of the following is true with respect to AUG.
Out of A=T, G =C pairing, bases of DNA may exist in alternate valency state owing to arrangement called ______.
H. J. Muller was awarded Nobel Prize for his ______.
Amino acids which are specified by single codons are ______.
Sickle cell anemia results from a single base substitution in a gene, thus it is an example of ______.
Phenylalanine is a ______.
George Gamow suggested that each codon coding for an amino acid consists of ______
Which amino acid is determined by four genetic codes?
How many codons code for amino acid?
Which of the following statements is the most appropriate for sickle cell anaemia?
Based on your understanding of genetic code, explain the formation of any abnormal hemoglobin molecule. What are the known consequences of such a change?
A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct? Defend your answer.
Discuss the process of translation in detail.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
Who proposed that the genetic code for amino acids should be made up of three nucleotides?
