Advertisements
Advertisements
प्रश्न
Give an example of a codon having a dual function.
Advertisements
उत्तर
AUG performs a dual function. It codes for methionine (Met) and works as an initiator codon.
संबंधित प्रश्न
Write the contributions of the following scientists in deciphering the genetic code.
George Gamow; Hargobind Khorana; Marshall Nirenberg; Severo Ochoa
Differentiate between the genetic codes given below:
Degenerate and Initiator
Name the anticodon required to recognize the following codon: AAU.
Name the anticodon required to recognize the following codon: CGA
Name the anticodon required to recognize the following codon: GCA.
Frame shift mutation occurs when ______.
Khorana first deciphered the triplet codons of ______.
Because most of the amino acids are represented by more than one codon, the genetic code is ______.
Some amino acids are coded by more than one codon, hence the genetic code is ______.
The mutations that involve addition, deletion or substitution of a single pair in a gene are referred to as ______.
Sickle cell anemia results from a single base substitution in a gene, thus it is an example of ______.
Select the incorrectly matched pair.
Phenylalanine is a ______.
George Gamow suggested that each codon coding for an amino acid consists of ______
Genetic code is universal, it means ______
Which amino acid is determined by four genetic codes?
A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct? Defend your answer.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
Who proposed that the genetic code for amino acids should be made up of three nucleotides?
All the 64 codons in the dictionary of genetic code were deciphered by ______.
