Advertisements
Advertisements
प्रश्न
Discuss the process of translation in detail.
Advertisements
उत्तर
It is the process of polymerizing amino acid to form a polypeptide chain. The triplet sequence of base pairs in mRNA defines the order and sequence of amino acids in a polypeptide chain.
This process involves 3 steps.
- Initiation
- Elongation
- Termination. During the initiation, tRNA gets charged when the aminoacid binds to using ATP. The start codon (AUG) present on mRNA is recognized only by the charged tRNA. The ribosome acts as an actual site for the process of translation and contains two separate sites in a large subunit for the attachment of subsequent aminoacid. The small subunit of ribosome binds to mRNA at the initiation codon (AUG) followed by the large subunit. Then, it initiates the process of translation. During the elongation process, the ribosome moves one codon downstream along with mRNA so as to leave the space for binding of another charged tRNA. The aminoacid brought by tRNA gets linked with the previous aminoacid through a peptide bond and this process continues resulting in the formation of a polypeptide chain. When the ribosome reaches one or more STOP codon (UAA, UAG and UGA), the process of translation gets terminated. The polypeptide chain is released and ribosomes get detached from mRNA.
APPEARS IN
संबंधित प्रश्न
Write the contributions of the following scientists in deciphering the genetic code.
George Gamow; Hargobind Khorana; Marshall Nirenberg; Severo Ochoa
Differentiate between the genetic codes given below:
Degenerate and Initiator
Give reasons:
Genetic code is ‘universal’.
Name the anticodon required to recognize the following codon: UAU
One of the following is true with respect to AUG.
DNA is a polymer of nucleotides which are linked to each other by 3’-5’ phosphodiester bond. To prevent polymerisation of nucleotides, which of the following modifications would you choose?
Because most of the amino acids are represented by more than one codon, the genetic code is ______.
The change of the light coloured variety of peppered moth (Biston betularia) to its darker variety (Biston carbonarid) is due to ______.
Some amino acids are coded by more than one codon, hence the genetic code is ______.
Percentage of mitochondrial DNA in the cell is:
Which amino acid is determined by four genetic codes?
Frame shift mutations are caused by ______.
Which of the following statements is the most appropriate for sickle cell anaemia?
Based on your understanding of genetic code, explain the formation of any abnormal hemoglobin molecule. What are the known consequences of such a change?
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
