Advertisements
Advertisements
Question
Discuss the process of translation in detail.
Advertisements
Solution
It is the process of polymerizing amino acid to form a polypeptide chain. The triplet sequence of base pairs in mRNA defines the order and sequence of amino acids in a polypeptide chain.
This process involves 3 steps.
- Initiation
- Elongation
- Termination. During the initiation, tRNA gets charged when the aminoacid binds to using ATP. The start codon (AUG) present on mRNA is recognized only by the charged tRNA. The ribosome acts as an actual site for the process of translation and contains two separate sites in a large subunit for the attachment of subsequent aminoacid. The small subunit of ribosome binds to mRNA at the initiation codon (AUG) followed by the large subunit. Then, it initiates the process of translation. During the elongation process, the ribosome moves one codon downstream along with mRNA so as to leave the space for binding of another charged tRNA. The aminoacid brought by tRNA gets linked with the previous aminoacid through a peptide bond and this process continues resulting in the formation of a polypeptide chain. When the ribosome reaches one or more STOP codon (UAA, UAG and UGA), the process of translation gets terminated. The polypeptide chain is released and ribosomes get detached from mRNA.
APPEARS IN
RELATED QUESTIONS
Write the contributions of the following scientists in deciphering the genetic code.
George Gamow; Hargobind Khorana; Marshall Nirenberg; Severo Ochoa
Name the anticodon required to recognize the following codon: CGA
Name the anticodon required to recognize the following codon: UAU
Name the anticodon required to recognize the following codon: GCA.
Out of A=T, G =C pairing, bases of DNA may exist in alternate valency state owing to arrangement called ______.
Which of the following organ is essential for photorespiration?
Percentage of mitochondrial DNA in the cell is:
Genetic code translates the language of:
What would happen if in a gene encoding a polypeptide of so amino acid 25th (UAC) is match to UAA?
George Gamow suggested that each codon coding for an amino acid consists of ______
How many codons code for amino acid?
Which of the following statements is the most appropriate for sickle cell anaemia?
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
All the 64 codons in the dictionary of genetic code were deciphered by ______.
How many amino acids can be coded by a doublet codon system?
According to George Gamow's proposal from 1954, why is the genetic code a triplet code?
Which enzyme did Severo Ochoa identify as capable of polymerizing RNA with defined sequences in a template-independent manner?
Which of the following sets of codons all code for the same amino acid, demonstrating degeneracy?
How many codons code for amino acids and how many are stop codons?
