Advertisements
Advertisements
प्रश्न
Discuss the process of translation in detail.
Advertisements
उत्तर
It is the process of polymerizing amino acid to form a polypeptide chain. The triplet sequence of base pairs in mRNA defines the order and sequence of amino acids in a polypeptide chain.
This process involves 3 steps.
- Initiation
- Elongation
- Termination. During the initiation, tRNA gets charged when the aminoacid binds to using ATP. The start codon (AUG) present on mRNA is recognized only by the charged tRNA. The ribosome acts as an actual site for the process of translation and contains two separate sites in a large subunit for the attachment of subsequent aminoacid. The small subunit of ribosome binds to mRNA at the initiation codon (AUG) followed by the large subunit. Then, it initiates the process of translation. During the elongation process, the ribosome moves one codon downstream along with mRNA so as to leave the space for binding of another charged tRNA. The aminoacid brought by tRNA gets linked with the previous aminoacid through a peptide bond and this process continues resulting in the formation of a polypeptide chain. When the ribosome reaches one or more STOP codon (UAA, UAG and UGA), the process of translation gets terminated. The polypeptide chain is released and ribosomes get detached from mRNA.
APPEARS IN
संबंधित प्रश्न
Differentiate between the genetic codes given below:
Unambiguous and Universal
Name the anticodon required to recognize the following codon: CGA
Name the anticodon required to recognize the following codon: GCA.
Frame shift mutation occurs when ______.
Khorana first deciphered the triplet codons of ______.
Out of A=T, G =C pairing, bases of DNA may exist in alternate valency state owing to arrangement called ______.
H. J. Muller was awarded Nobel Prize for his ______.
Amino acids which are specified by single codons are ______.
The mutations that involve addition, deletion or substitution of a single pair in a gene are referred to as ______.
Select the incorrectly matched pair.
If the sequence of bases in coding strand of DNA is ATTCGATG, then the sequence of bases in mRNA will be ______.
Genetic code translates the language of:
Genetic code was discovered by:
Genetic code is universal, it means ______
Which amino acid is determined by four genetic codes?
Frame shift mutations are caused by ______.
Based on your understanding of genetic code, explain the formation of any abnormal hemoglobin molecule. What are the known consequences of such a change?
There is only one possible sequence of amino acids when deduced from a given nucleotides. But multiple nucleotides sequence can be deduced from a single amino acid sequence. Explain this phenomena.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
