Advertisements
Advertisements
प्रश्न
There is only one possible sequence of amino acids when deduced from a given nucleotides. But multiple nucleotides sequence can be deduced from a single amino acid sequence. Explain this phenomena.
Advertisements
उत्तर
Some amino acids are coded by more than one codon (known as degeneracy of codons), hence on deducing a nucleotide sequence from an amino acid sequence, multiple nucleotide sequence will be obtained. For e.g., Ile has three codous: AUU, AUC AUA hence a depeptide Met–Ile can have the following nucleotide sequence:
- AUG – AUU
- AUG – AUC
- AUG – AUA
and if, we deduce amino acid sequence for the above nucleotide sequences, all the three will code for Met–Ile
APPEARS IN
संबंधित प्रश्न
Differentiate between the genetic codes given below:
Degenerate and Initiator
Give reasons:
Genetic code is ‘universal’.
Name the anticodon required to recognize the following codon: CGA
Name the anticodon required to recognize the following codon: GCA.
One of the following is true with respect to AUG.
Genetic code is ______.
The change of the light coloured variety of peppered moth (Biston betularia) to its darker variety (Biston carbonarid) is due to ______.
Which out of the following statements is incorrect?
Some amino acids are coded by more than one codon, hence the genetic code is ______.
The mutations that involve addition, deletion or substitution of a single pair in a gene are referred to as ______.
Methionine carrying tRNA has anticodon:
Which of the following statements is the most appropriate for sickle cell anaemia?
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
How many amino acids can be coded by a doublet codon system?
How many codons in total exist in the genetic code?
What is the start codon and which amino acid does it code for?
Which scientist developed a method for synthesizing RNA molecules with repeated known nucleotide sequences to help decipher the genetic code?
Which of the following sets of codons all code for the same amino acid, demonstrating degeneracy?
Which of the following statements correctly describes the universality of the genetic code?
