हिंदी
कर्नाटक बोर्ड पी.यू.सी.पीयूसी विज्ञान 2nd PUC Class 12

There is only one possible sequence of amino acids when deduced from a given nucleotides. But multiple nucleotides sequence can be deduced from a single amino acid sequence. Explain this phenomena.

Advertisements
Advertisements

प्रश्न

There is only one possible sequence of amino acids when deduced from a given nucleotides. But multiple nucleotides sequence can be deduced from a single amino acid sequence. Explain this phenomena.

टिप्पणी लिखिए
Advertisements

उत्तर

Some amino acids are coded by more than one codon (known as degeneracy of codons), hence on deducing a nucleotide sequence from an amino acid sequence, multiple nucleotide sequence will be obtained. For e.g., Ile has three codous: AUU, AUC AUA hence a depeptide Met–Ile can have the following nucleotide sequence:

  1. AUG – AUU
  2. AUG – AUC
  3. AUG – AUA

and if, we deduce amino acid sequence for the above nucleotide sequences, all the three will code for Met–Ile

shaalaa.com
  क्या इस प्रश्न या उत्तर में कोई त्रुटि है?
अध्याय 6: Molecular Basis of Inheritance - SHORT ANSWER [पृष्ठ ४२]

APPEARS IN

एनसीईआरटी एक्झांप्लर Biology Exemplar [English] Class 12
अध्याय 6 Molecular Basis of Inheritance
SHORT ANSWER | Q 12. | पृष्ठ ४२

संबंधित प्रश्न

Answer the following question.
State the importance of a Genetic code in protein biosynthesis.


Differentiate between the genetic codes given below:
Unambiguous and Universal


Name the anticodon required to recognize the following codon: CGA


Name the anticodon required to recognize the following codon: UAU


DNA is a polymer of nucleotides which are linked to each other by 3’-5’ phosphodiester bond. To prevent polymerisation of nucleotides, which of the following modifications would you choose?


Frame shift mutation occurs when ______.


Khorana first deciphered the triplet codons of ______.


Out of A=T, G =C pairing, bases of DNA may exist in alternate valency state owing to arrangement called ______.


Which out of the following statements is incorrect?


If the sequence of bases in coding strand of DNA is ATTCGATG, then the sequence of bases in mRNA will be ______.


Which of the following organ is essential for photorespiration?


What would happen if in a gene encoding a polypeptide of so amino acid 25th (UAC) is match to UAA?


Genetic code is universal, it means ______


Statement I:

The codon ‘AUG’ codes for methionine and phenylalanine.

Statement II:

‘AAA’ and ‘AAG’ are both codons that code for the amino acid lysine.

In light of the above statements, choose the correct answer from the options given below.


Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'


Which one of the following is a termination codon?


Who proposed that the genetic code for amino acids should be made up of three nucleotides?


Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×