Advertisements
Advertisements
प्रश्न
There is only one possible sequence of amino acids when deduced from a given nucleotides. But multiple nucleotides sequence can be deduced from a single amino acid sequence. Explain this phenomena.
Advertisements
उत्तर
Some amino acids are coded by more than one codon (known as degeneracy of codons), hence on deducing a nucleotide sequence from an amino acid sequence, multiple nucleotide sequence will be obtained. For e.g., Ile has three codous: AUU, AUC AUA hence a depeptide Met–Ile can have the following nucleotide sequence:
- AUG – AUU
- AUG – AUC
- AUG – AUA
and if, we deduce amino acid sequence for the above nucleotide sequences, all the three will code for Met–Ile
APPEARS IN
संबंधित प्रश्न
Give an example of a codon having a dual function.
Give reasons:
Genetic code is ‘universal’.
Name the anticodon required to recognize the following codon: CGA
Genetic code is ______.
The change of the light coloured variety of peppered moth (Biston betularia) to its darker variety (Biston carbonarid) is due to ______.
Amino acids which are specified by single codons are ______.
Which out of the following statements is incorrect?
Which of the following organ is essential for photorespiration?
Percentage of mitochondrial DNA in the cell is:
Genetic code was discovered by:
What would happen if in a gene encoding a polypeptide of so amino acid 25th (UAC) is match to UAA?
George Gamow suggested that each codon coding for an amino acid consists of ______
How many codons code for amino acid?
Frame shift mutations are caused by ______.
A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct? Defend your answer.
Discuss the process of translation in detail.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
Who proposed that the genetic code for amino acids should be made up of three nucleotides?
All the 64 codons in the dictionary of genetic code were deciphered by ______.
