Advertisements
Advertisements
प्रश्न
There is only one possible sequence of amino acids when deduced from a given nucleotides. But multiple nucleotides sequence can be deduced from a single amino acid sequence. Explain this phenomena.
Advertisements
उत्तर
Some amino acids are coded by more than one codon (known as degeneracy of codons), hence on deducing a nucleotide sequence from an amino acid sequence, multiple nucleotide sequence will be obtained. For e.g., Ile has three codous: AUU, AUC AUA hence a depeptide Met–Ile can have the following nucleotide sequence:
- AUG – AUU
- AUG – AUC
- AUG – AUA
and if, we deduce amino acid sequence for the above nucleotide sequences, all the three will code for Met–Ile
APPEARS IN
संबंधित प्रश्न
Write the contributions of the following scientists in deciphering the genetic code.
George Gamow; Hargobind Khorana; Marshall Nirenberg; Severo Ochoa
Answer the following question.
State the importance of a Genetic code in protein biosynthesis.
Differentiate between the genetic codes given below:
Unambiguous and Universal
Differentiate between the genetic codes given below:
Degenerate and Initiator
Name the anticodon required to recognize the following codon: CGA
Out of A=T, G =C pairing, bases of DNA may exist in alternate valency state owing to arrangement called ______.
Which out of the following statements is incorrect?
If the sequence of bases in coding strand of DNA is ATTCGATG, then the sequence of bases in mRNA will be ______.
AUG on the mRNA will result in the activation of which of the following RNA having the correct combination of amino acids:
| Site A | Site B | |
| A. | UAC | Methionine |
| B. | Methionine | UAC |
| C. | Methionine | AUG |
| D. | AUG | Methionine |
Which of the following organ is essential for photorespiration?
Methionine carrying tRNA has anticodon:
Genetic code was discovered by:
George Gamow suggested that each codon coding for an amino acid consists of ______
Genetic code is universal, it means ______
How many codons code for amino acid?
Discuss the process of translation in detail.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
