मराठी

Name the anticodon required to recognize the following codon: AAU.

Advertisements
Advertisements

प्रश्न

Name the anticodon required to recognize the following codon: AAU.

एक शब्द/वाक्यांश उत्तर
Advertisements

उत्तर

UUA

shaalaa.com
  या प्रश्नात किंवा उत्तरात काही त्रुटी आहे का?
पाठ 5: Molecular Genetics - Evaluation [पृष्ठ ८६]

APPEARS IN

सामाचीर कलवी Biology (Zoology) [English] Class 12 TN Board
पाठ 5 Molecular Genetics
Evaluation | Q 29. | पृष्ठ ८६
सामाचीर कलवी Biology (Zoology) [English] Class 12 TN Board
पाठ 5 Molecular Genetics
Evaluation | Q 29. | पृष्ठ ८९
नूतन Biology [English] Class 12 ISC
पाठ 5 Molecular Basis of Inheritance
TEST YOUR PROGRESS | Q 5. (i) | पृष्ठ २७१

संबंधित प्रश्‍न

Answer the following question.
State the importance of a Genetic code in protein biosynthesis.


Differentiate between the genetic codes given below:
Unambiguous and Universal


The first codon to be deciphered was ______ which codes for ______.


Name the anticodon required to recognize the following codon: GCA.


Amino acids which are specified by single codons are ______.


Some amino acids are coded by more than one codon, hence the genetic code is ______.


Select the incorrectly matched pair.


If the sequence of bases in coding strand of DNA is ATTCGATG, then the sequence of bases in mRNA will be ______.


AUG on the mRNA will result in the activation of which of the following RNA having the correct combination of amino acids: 

  Site A Site B
A. UAC Methionine
B. Methionine UAC
C. Methionine AUG
D. AUG Methionine

Which of the following organ is essential for photorespiration?


Phenylalanine is a ______.


Genetic code was discovered by:


How many codons code for amino acid?


Statement I: The codon ‘AUG’ codes for methionine and phenylalanine.

Statement II: ‘AAA’ and ‘AAG’ both codons code for the amino acid lysine.

In the light of the above statements, choose the correct answer from the options given below.


Statement I:

The codon ‘AUG’ codes for methionine and phenylalanine.

Statement II:

‘AAA’ and ‘AAG’ are both codons that code for the amino acid lysine.

In light of the above statements, choose the correct answer from the options given below.


Discuss the process of translation in detail.


Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'


All the 64 codons in the dictionary of genetic code were deciphered by ______.


Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×