English

Give an example of a codon having a dual function. - Biology

Advertisements
Advertisements

Question

Give an example of a codon having a dual function.

Very Short Answer
Advertisements

Solution

AUG performs a dual function. It codes for methionine (Met) and works as an initiator codon.

shaalaa.com
  Is there an error in this question or solution?
Chapter 6: Molecular Basis of Inheritance - Test Your Progress [Page 272]

APPEARS IN

Nootan Biology [English] Class 12 ISC
Chapter 6 Molecular Basis of Inheritance
Test Your Progress | Q 38. | Page 272

RELATED QUESTIONS

Write the contributions of the following scientists in deciphering the genetic code.
George Gamow; Hargobind Khorana; Marshall Nirenberg; Severo Ochoa


Give reasons:

Genetic code is ‘universal’.


Name the anticodon required to recognize the following codon: GCA.


Genetic code is ______.


The number of base substitution possible in amino acid codons is ______.


Amino acids which are specified by single codons are ______.


The mutations that involve addition, deletion or substitution of a single pair in a gene are referred to as ______.


If the sequence of bases in coding strand of DNA is ATTCGATG, then the sequence of bases in mRNA will be ______.


George Gamow suggested that each codon coding for an amino acid consists of ______


Genetic code is universal, it means ______


Frame shift mutations are caused by ______.


Statement I: The codon ‘AUG’ codes for methionine and phenylalanine.

Statement II: ‘AAA’ and ‘AAG’ both codons code for the amino acid lysine.

In the light of the above statements, choose the correct answer from the options given below.


Based on your understanding of genetic code, explain the formation of any abnormal hemoglobin molecule. What are the known consequences of such a change?


A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct? Defend your answer.


There is only one possible sequence of amino acids when deduced from a given nucleotides. But multiple nucleotides sequence can be deduced from a single amino acid sequence. Explain this phenomena.


Discuss the process of translation in detail.


Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'


Who proposed that the genetic code for amino acids should be made up of three nucleotides?


Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×