Advertisements
Advertisements
Question
Give an example of a codon having a dual function.
Advertisements
Solution
AUG performs a dual function. It codes for methionine (Met) and works as an initiator codon.
RELATED QUESTIONS
Write the contributions of the following scientists in deciphering the genetic code.
George Gamow; Hargobind Khorana; Marshall Nirenberg; Severo Ochoa
The first codon to be deciphered was ______ which codes for ______.
Give reasons:
Genetic code is ‘universal’.
Name the anticodon required to recognize the following codon: GCA.
Genetic code is ______.
Khorana first deciphered the triplet codons of ______.
Because most of the amino acids are represented by more than one codon, the genetic code is ______.
Amino acids which are specified by single codons are ______.
Some amino acids are coded by more than one codon, hence the genetic code is ______.
The mutations that involve addition, deletion or substitution of a single pair in a gene are referred to as ______.
Sickle cell anemia results from a single base substitution in a gene, thus it is an example of ______.
Which of the following organ is essential for photorespiration?
Genetic code was discovered by:
Which amino acid is determined by four genetic codes?
There is only one possible sequence of amino acids when deduced from a given nucleotides. But multiple nucleotides sequence can be deduced from a single amino acid sequence. Explain this phenomena.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
All the 64 codons in the dictionary of genetic code were deciphered by ______.
