Advertisements
Advertisements
प्रश्न
Based on your understanding of genetic code, explain the formation of any abnormal hemoglobin molecule. What are the known consequences of such a change?
Advertisements
उत्तर
The defect is caused by the substitution (trans version) of Glutamic acid (Glu) by Valine (Val) at the sixth position of the betaglobin chain of the haemoglobin molecule. The substitution of amino acid in the glob in protein results due to the single base substitution at the sixth codon of the betaglobin gene from GAG to GUG. The mutant haemoglobin molecule undergoes polymerisation under low oxygen tension causing the change in the shape of the RBC from biconcave disc to elongated sickle-like structure. Sickle-shaped red blood cells that obstruct capillaries and restrict blood flow to an organ resulting in ischaemia, pain, necrosis, and often organ damage.
APPEARS IN
संबंधित प्रश्न
The first codon to be deciphered was ______ which codes for ______.
Give reasons:
Genetic code is ‘universal’.
Name the anticodon required to recognize the following codon: AAU.
Name the anticodon required to recognize the following codon: CGA
Name the anticodon required to recognize the following codon: GCA.
DNA is a polymer of nucleotides which are linked to each other by 3’-5’ phosphodiester bond. To prevent polymerisation of nucleotides, which of the following modifications would you choose?
Khorana first deciphered the triplet codons of ______.
Because most of the amino acids are represented by more than one codon, the genetic code is ______.
The number of base substitution possible in amino acid codons is ______.
H. J. Muller was awarded Nobel Prize for his ______.
Amino acids which are specified by single codons are ______.
Which out of the following statements is incorrect?
Some amino acids are coded by more than one codon, hence the genetic code is ______.
AUG on the mRNA will result in the activation of which of the following RNA having the correct combination of amino acids:
| Site A | Site B | |
| A. | UAC | Methionine |
| B. | Methionine | UAC |
| C. | Methionine | AUG |
| D. | AUG | Methionine |
Percentage of mitochondrial DNA in the cell is:
How many codons code for amino acid?
Statement I:
The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II:
‘AAA’ and ‘AAG’ are both codons that code for the amino acid lysine.
In light of the above statements, choose the correct answer from the options given below.
There is only one possible sequence of amino acids when deduced from a given nucleotides. But multiple nucleotides sequence can be deduced from a single amino acid sequence. Explain this phenomena.
Discuss the process of translation in detail.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
