Advertisements
Advertisements
प्रश्न
Based on your understanding of genetic code, explain the formation of any abnormal hemoglobin molecule. What are the known consequences of such a change?
Advertisements
उत्तर
The defect is caused by the substitution (trans version) of Glutamic acid (Glu) by Valine (Val) at the sixth position of the betaglobin chain of the haemoglobin molecule. The substitution of amino acid in the glob in protein results due to the single base substitution at the sixth codon of the betaglobin gene from GAG to GUG. The mutant haemoglobin molecule undergoes polymerisation under low oxygen tension causing the change in the shape of the RBC from biconcave disc to elongated sickle-like structure. Sickle-shaped red blood cells that obstruct capillaries and restrict blood flow to an organ resulting in ischaemia, pain, necrosis, and often organ damage.
APPEARS IN
संबंधित प्रश्न
Write the contributions of the following scientists in deciphering the genetic code.
George Gamow; Hargobind Khorana; Marshall Nirenberg; Severo Ochoa
DNA is a polymer of nucleotides which are linked to each other by 3’-5’ phosphodiester bond. To prevent polymerisation of nucleotides, which of the following modifications would you choose?
Genetic code is ______.
Because most of the amino acids are represented by more than one codon, the genetic code is ______.
The number of base substitution possible in amino acid codons is ______.
Out of A=T, G =C pairing, bases of DNA may exist in alternate valency state owing to arrangement called ______.
Which out of the following statements is incorrect?
The mutations that involve addition, deletion or substitution of a single pair in a gene are referred to as ______.
Select the incorrectly matched pair.
If the sequence of bases in coding strand of DNA is ATTCGATG, then the sequence of bases in mRNA will be ______.
Which of the following organ is essential for photorespiration?
George Gamow suggested that each codon coding for an amino acid consists of ______
How many codons code for amino acid?
Frame shift mutations are caused by ______.
A single base mutation in a gene may not ‘always’ result in loss or gain of function. Do you think the statement is correct? Defend your answer.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
