Advertisements
Advertisements
प्रश्न
Based on your understanding of genetic code, explain the formation of any abnormal hemoglobin molecule. What are the known consequences of such a change?
Advertisements
उत्तर
The defect is caused by the substitution (trans version) of Glutamic acid (Glu) by Valine (Val) at the sixth position of the betaglobin chain of the haemoglobin molecule. The substitution of amino acid in the glob in protein results due to the single base substitution at the sixth codon of the betaglobin gene from GAG to GUG. The mutant haemoglobin molecule undergoes polymerisation under low oxygen tension causing the change in the shape of the RBC from biconcave disc to elongated sickle-like structure. Sickle-shaped red blood cells that obstruct capillaries and restrict blood flow to an organ resulting in ischaemia, pain, necrosis, and often organ damage.
APPEARS IN
संबंधित प्रश्न
Answer the following question.
State the importance of a Genetic code in protein biosynthesis.
Differentiate between the genetic codes given below:
Degenerate and Initiator
DNA is a polymer of nucleotides which are linked to each other by 3’-5’ phosphodiester bond. To prevent polymerisation of nucleotides, which of the following modifications would you choose?
Genetic code is ______.
Out of A=T, G =C pairing, bases of DNA may exist in alternate valency state owing to arrangement called ______.
Which of the following organ is essential for photorespiration?
Phenylalanine is a ______.
Genetic code was discovered by:
Genetic code is universal, it means ______
Statement I:
The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II:
‘AAA’ and ‘AAG’ are both codons that code for the amino acid lysine.
In light of the above statements, choose the correct answer from the options given below.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
Who proposed that the genetic code for amino acids should be made up of three nucleotides?
All the 64 codons in the dictionary of genetic code were deciphered by ______.
How many amino acids can be coded by a doublet codon system?
Which of the following statements about stop codons is correct?
Which of the following sets of codons all code for the same amino acid, demonstrating degeneracy?
Which of the following statements correctly describes the universality of the genetic code?
How many codons code for amino acids and how many are stop codons?
