Advertisements
Advertisements
Question
Based on your understanding of genetic code, explain the formation of any abnormal hemoglobin molecule. What are the known consequences of such a change?
Advertisements
Solution
The defect is caused by the substitution (trans version) of Glutamic acid (Glu) by Valine (Val) at the sixth position of the betaglobin chain of the haemoglobin molecule. The substitution of amino acid in the glob in protein results due to the single base substitution at the sixth codon of the betaglobin gene from GAG to GUG. The mutant haemoglobin molecule undergoes polymerisation under low oxygen tension causing the change in the shape of the RBC from biconcave disc to elongated sickle-like structure. Sickle-shaped red blood cells that obstruct capillaries and restrict blood flow to an organ resulting in ischaemia, pain, necrosis, and often organ damage.
APPEARS IN
RELATED QUESTIONS
DNA is a polymer of nucleotides which are linked to each other by 3’-5’ phosphodiester bond. To prevent polymerisation of nucleotides, which of the following modifications would you choose?
Genetic code is ______.
The number of base substitution possible in amino acid codons is ______.
Out of A=T, G =C pairing, bases of DNA may exist in alternate valency state owing to arrangement called ______.
The change of the light coloured variety of peppered moth (Biston betularia) to its darker variety (Biston carbonarid) is due to ______.
Some amino acids are coded by more than one codon, hence the genetic code is ______.
The mutations that involve addition, deletion or substitution of a single pair in a gene are referred to as ______.
Phenylalanine is a ______.
George Gamow suggested that each codon coding for an amino acid consists of ______
Genetic code is universal, it means ______
Statement I:
The codon ‘AUG’ codes for methionine and phenylalanine.
Statement II:
‘AAA’ and ‘AAG’ are both codons that code for the amino acid lysine.
In light of the above statements, choose the correct answer from the options given below.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
Who proposed that the genetic code for amino acids should be made up of three nucleotides?
How many codons in total exist in the genetic code?
Which of the following statements about stop codons is correct?
What is the start codon and which amino acid does it code for?
Which scientist proved the triplet nature of the genetic code through frame-shift mutation experiments in 1961?
Which scientist developed a method for synthesizing RNA molecules with repeated known nucleotide sequences to help decipher the genetic code?
Which of the following sets of codons all code for the same amino acid, demonstrating degeneracy?
