Advertisements
Advertisements
प्रश्न
Describe the process of transcription in bacteria
Advertisements
उत्तर
Transcription has three steps—initiation, elongation, and termination.
Initiation:
RNA polymerase binds with the promoter to initiate the process of transcription. Association with the initiation factor (σ) alters the specificity of RNA polymerase to initiate transcription.
Elongation:
RNA polymerase uses nucleoside triphosphate as the substrate, and polymerisation occurs according to complementarity.
Termination:
Termination occurs when the termination factor (rho) alters the specificity of RNA polymerase to terminate transcription. As the RNA polymerase proceeds to perform elongation, a short stretch of RNA remains bound to the enzyme. As the enzyme reaches the termination region, this nascent RNA falls off and transcription is terminated.

APPEARS IN
संबंधित प्रश्न
- Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides.
- Explain the basis on which he arrived at this conclusion.
Name the enzyme responsible for the transcription of tRNA and the amino acid the initiator tRNA gets linked with.
Explain the role of initiator tRNA in the initiation of protein synthesis.
What are introns?
Transcription is the transfer of genetic code from a DNA molecule to ______.
A mRNA molecule is produced by ______.
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
DNA template sequence of CTGATAGC is transcribed over mRNA as ______.
Which factor is important for termination of transcription?
Match List I with List II.
| List I | List II |
| A. RNA polymerase III | I. snRNPs |
| B. Termination of transcription | II. Promotor |
| C. Splicing of Exons | III. Rho factor |
| D. TATA box | IV. SnRNAs, tRNA |
Choose the correct answer from the options given below:
