Advertisements
Advertisements
प्रश्न
State the aim and describe Messelson and Stahl’s experiment.
Advertisements
उत्तर
Messelson and Stahl in 1958 aimed at proving that the DNA replicates in a semi-conservative fashion. The semi-conservative DNA replication suggests that after the completion of replication, each DNA molecule will have one parental and one newly-synthesised strand.
Experimental proof
(1) E.coli was grown in a medium containing 15NH4Cl (15N is the heavy isotope of nitrogen) as the only nitrogen source for many generations. As a result, 15N was incorporated into
the newly-synthesised DNA. This heavy DNA could be distinguished by centrifugations in CsCl density gradient.
(2) Then, these E. coli cells were transferred to a medium with normal 14NH4 Cl and the DNA was extracted as double-stranded helix. The various samples were separated on CsCl gradients for measuring the density of DNA.
(3) After 40 minutes, the DNA of the second generation was extracted from the
14NH4Cl medium and was found to have equal amounts of hybrid and light DNA.

APPEARS IN
संबंधित प्रश्न
Following are the features of genetic codes. What does each one indicate?
Stop codon; Unambiguous codon; Degenerate codon; Universal codon.
Describe the process of transcription in bacteria
How is Prokaryotic Transcription process different in eukaryotes?
Initiation codon of protein synthesis in Eukaryotes is ______.
Explain the mechanism of transcription in a prokaryotic cell.
A mRNA molecule is produced by ______.
Which of the following is the correct sequence of event with reference to the central dogma?
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
In a cell, DNA transcription is halted when ______
The process of copying genetic information from one strand of the DNA into RNA is termed as ______
