Advertisements
Advertisements
प्रश्न
Explain the processing the hnRNA needs to undergo before becoming functional mRNA in eukaryotes.
Advertisements
उत्तर
In eukaryotes, the hnRNA (heterogeneous nuclear RNA) is the direct product of transcription and contains both coding exons and non-coding introns. To become functional mRNA, it must undergo three essential processing steps within the nucleus:
- Splicing: This is the most critical step, where the non-functional introns are removed, and the functional exons are joined together in a specific order. This process is carried out by a complex called the spliceosome.
- Capping: A unique nucleotide, methyl guanosine triphosphate, is added to the 5’ end of the hnRNA. This “cap” protects the RNA from degradation and helps the ribosome recognise it during translation.
- Tailing (Polyadenylation): About 200–300 adenylate residues are added to the 3’ end of the RNA, forming what is known as a poly-A tail. This tail assists in the export of the mRNA from the nucleus and further stabilises the molecule.
Once these three modifications are complete, the processed transcript is called mature mRNA and is then transported out of the nucleus into the cytoplasm for protein synthesis.
संबंधित प्रश्न
Describe the process of transcription in bacteria
Explain the process of transcription in prokaryotes.
- Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides.
- Explain the basis on which he arrived at this conclusion.
State the aim and describe Messelson and Stahl’s experiment.
Briefly describe the following:
Transcription
How is Prokaryotic Transcription process different in eukaryotes?
What are introns?
What is the central dogma?
Explain the mechanism of transcription in a prokaryotic cell.
A mRNA molecule is produced by ______.
Name the parts marked ‘A’ and ‘B’ in the given transcription unit:

If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
How is the two stage process of protein synthesis advantageous?
The process of transfer of genetic information from DNA to RNA/formation of RNA from DNA is ______.
Reverse transcriptase is ______.
DNA template sequence of CTGATAGC is transcribed over mRNA as ______.
In a cell, DNA transcription is halted when ______
