Advertisements
Advertisements
प्रश्न
Explain the mechanism of transcription in a prokaryotic cell.
Advertisements
उत्तर
Transcription is the process of copying genetic information from the sense strand of DNA into RNA. Only a segment of DNA is transcribed, and only one of the two strands is copied. In prokaryotes, transcription occurs in contact with the cytoplasm as their DNA lies in the cytoplasm. Transcription requires a DNA-dependent enzyme, RNA polymerase. Prokaryotes have only one RNA polymerase, which synthesises all types of RNAs. The transcription includes the following steps:
- Activation of nucleotides in the nucleoplasm through phosphorylation. These are ATP, GTP, UTP and CTP.
- A single RNA polymerase binds to the promoter site/region of the DNA template. Chain opening of the DNA segment by uncoiling occurs from the site of polymerase binding.
- Initiation of transcription occurs by the complementary pairing of free activated ribonucleotides with the nitrogen bases of the DNA template.
- Activated ribonucleotide triphosphate acts as a substrate and also provides energy for polymerisation on a template following the rule of complementarity.
- As the RNA chain formation initiates, the sigma(cr) factor of RNA polymerase separates. RNA polymerase moves along the DNA template, causing elongation of the RNA chain.
- RNA synthesis stops as soon as the polymerase reaches the terminator region. Rho(p) factor is required for this. The Terminator region has a stop signal.
- The Rho factor helps the release of nascent RNA, and RNA polymerase falls off. It is the termination of transcription.

- In prokaryotes, the n-RNA synthesis does not require any processing to become active, and both transcription and translation occur in the same cytosol.
- Translation can start well before the mRNA is fully transcribed, i.e., transcription and translation can be coupled.
APPEARS IN
संबंधित प्रश्न
Following are the features of genetic codes. What does each one indicate?
Stop codon; Unambiguous codon; Degenerate codon; Universal codon.
How do m-RNA, t-RNA and ribosomes help in the process of translation?
Explain the process of transcription in prokaryotes.
Briefly describe the following:
Transcription
Explain the role of initiator tRNA in the initiation of protein synthesis.
What are introns?
A mRNA molecule is produced by ______.
Which of the following is the correct sequence of event with reference to the central dogma?
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
In a cell, DNA transcription is halted when ______
