Advertisements
Advertisements
प्रश्न
Following are the features of genetic codes. What does each one indicate?
Stop codon; Unambiguous codon; Degenerate codon; Universal codon.
Advertisements
उत्तर
Features of the genetic code:
Stop codon: Signals termination of translation and does not code for any amino acid.
Unambiguous codon: Each codon codes for only one amino acid.
Degenerate codon: More than one codon can code for a specific amino acid.
Universal codon: One codon codes for the same amino acid in all species.
APPEARS IN
संबंधित प्रश्न
- Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides.
- Explain the basis on which he arrived at this conclusion.
What are introns?
Initiation codon of protein synthesis in Eukaryotes is ______.
Explain the mechanism of transcription in a prokaryotic cell.
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
The process of copying genetic information from one strand of the DNA into RNA is termed as ______
Which factor is important for termination of transcription?
Which nucleotide replaces thymine during the transcription process when RNA is synthesized?
How many DNA strands serve as the template strand during transcription?
How many stages does transcription occur in?
