Advertisements
Advertisements
प्रश्न
How do m-RNA, t-RNA and ribosomes help in the process of translation?
Advertisements
उत्तर
Role of m-RNA, t-RNA and ribosomes in protein synthesis:
(i) m-RNA: The messenger RNA brings coded information from DNA and takes part in its translation by bringing amino acids in a particular sequence during the synthesis of a polypeptide. The same m-RNA can be reused many times.
(ii) t-RNA: They transfer RNAs which pick up particular amino acids in the process called charging, and they carry them to m-RNA over particular codons corresponding to their anticodons. Each t-RNA has an area for coming in contact with ribosome and the enzyme amino acyl tRNA synthetase.
(iii) Ribosomes: Ribosomes are protein factories. Each ribosome has two subunits— smaller and larger subunits. The larger subunit has a groove for pushing out the newly formed polypeptide and for protecting the same from cellular enzymes. The smaller subunit fits like a cap over the larger one and leaves a tunnel for m-RNA. The smaller subunit has a point for recognising m-RNA and binding area for initiation factors.
APPEARS IN
संबंधित प्रश्न
Name the enzyme responsible for the transcription of tRNA and the amino acid the initiator tRNA gets linked with.
Transcription is the transfer of genetic code from a DNA molecule to ______.
Initiation codon of protein synthesis in Eukaryotes is ______.
A mRNA molecule is produced by ______.
Which of the following is the correct sequence of event with reference to the central dogma?
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
DNA template sequence of CTGATAGC is transcribed over mRNA as ______.
The process of copying genetic information from one strand of the DNA into RNA is termed as ______
Which factor is important for termination of transcription?
Match List I with List II.
| List I | List II |
| A. RNA polymerase III | I. snRNPs |
| B. Termination of transcription | II. Promotor |
| C. Splicing of Exons | III. Rho factor |
| D. TATA box | IV. SnRNAs, tRNA |
Choose the correct answer from the options given below:
