Advertisements
Advertisements
Question
How do m-RNA, t-RNA and ribosomes help in the process of translation?
Advertisements
Solution
Role of m-RNA, t-RNA and ribosomes in protein synthesis:
(i) m-RNA: The messenger RNA brings coded information from DNA and takes part in its translation by bringing amino acids in a particular sequence during the synthesis of a polypeptide. The same m-RNA can be reused many times.
(ii) t-RNA: They transfer RNAs which pick up particular amino acids in the process called charging, and they carry them to m-RNA over particular codons corresponding to their anticodons. Each t-RNA has an area for coming in contact with ribosome and the enzyme amino acyl tRNA synthetase.
(iii) Ribosomes: Ribosomes are protein factories. Each ribosome has two subunits— smaller and larger subunits. The larger subunit has a groove for pushing out the newly formed polypeptide and for protecting the same from cellular enzymes. The smaller subunit fits like a cap over the larger one and leaves a tunnel for m-RNA. The smaller subunit has a point for recognising m-RNA and binding area for initiation factors.
APPEARS IN
RELATED QUESTIONS
- Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides.
- Explain the basis on which he arrived at this conclusion.
Briefly describe the following:
Transcription
Explain the role of initiator tRNA in the initiation of protein synthesis.
Transcription is the transfer of genetic code from a DNA molecule to ______.
What is the central dogma?
A mRNA molecule is produced by ______.
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
Read the following and answer from given below:
The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.
Which ion is essential for the association of both units of the ribosome at the time of protein formation?
The process of copying genetic information from one strand of the DNA into RNA is termed as ______
Match List I with List II.
| List I | List II |
| A. RNA polymerase III | I. snRNPs |
| B. Termination of transcription | II. Promotor |
| C. Splicing of Exons | III. Rho factor |
| D. TATA box | IV. SnRNAs, tRNA |
Choose the correct answer from the options given below:
