Advertisements
Advertisements
Question
(i) Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides.
(ii) Explain the basis on which he arrived at this conclusion.
Advertisements
Solution
(i) George Gamow suggested that the genetic code should be made up of a combination of three nucleotides.
(ii) He proposed that if 20 amino acids are to be coded by 4 bases, then the code should be made up of three nucleotides. 43 = 64 (42 = 16), which is less than 20. So, the codon was proposed to be triplet.
APPEARS IN
RELATED QUESTIONS
Explain the process of transcription in prokaryotes.
Name the enzyme responsible for the transcription of tRNA and the amino acid the initiator tRNA gets linked with.
State the aim and describe Messelson and Stahl’s experiment.
Briefly describe the following:
Transcription
Explain the role of initiator tRNA in the initiation of protein synthesis.
What is the central dogma?
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
Which is not involved in protein synthesis?
In a cell, DNA transcription is halted when ______
Read the following and answer from given below:
The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.
Which ion is essential for the association of both units of the ribosome at the time of protein formation?
