Advertisements
Advertisements
Questions
- Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides.
- Explain the basis on which he arrived at this conclusion.
Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides. Explain the basis on which he arrived at this conclusion.
Advertisements
Solution
- George Gamow suggested that the genetic code should be made up of a combination of three nucleotides.
- He proposed that if 20 amino acids are to be coded by 4 bases, then the code should be made up of three nucleotides. 43 = 64 (42 = 16), which is less than 20. So, the codon was proposed to be a triplet.
APPEARS IN
RELATED QUESTIONS
Describe the process of transcription in bacteria
Explain the process of transcription in prokaryotes.
Name the enzyme responsible for the transcription of tRNA and the amino acid the initiator tRNA gets linked with.
What are introns?
Transcription is the transfer of genetic code from a DNA molecule to ______.
Explain the mechanism of transcription in a prokaryotic cell.
Which of the following is the correct sequence of event with reference to the central dogma?
Name the parts marked ‘A’ and ‘B’ in the given transcription unit:
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
The process of transfer of genetic information from DNA to RNA/formation of RNA from DNA is ______.
DNA template sequence of CTGATAGC is transcribed over mRNA as ______.
Which is not involved in protein synthesis?
In a cell, DNA transcription is halted when ______
The process of copying genetic information from one strand of the DNA into RNA is termed as ______
Which factor is important for termination of transcription?
Match List I with List II.
| List I | List II |
| A. RNA polymerase III | I. snRNPs |
| B. Termination of transcription | II. Promotor |
| C. Splicing of Exons | III. Rho factor |
| D. TATA box | IV. SnRNAs, tRNA |
Choose the correct answer from the options given below:
