Advertisements
Advertisements
Questions
- Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides.
- Explain the basis on which he arrived at this conclusion.
Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides. Explain the basis on which he arrived at this conclusion.
Advertisements
Solution
- George Gamow suggested that the genetic code should be made up of a combination of three nucleotides.
- He proposed that if 20 amino acids are to be coded by 4 bases, then the code should be made up of three nucleotides. 43 = 64 (42 = 16), which is less than 20. So, the codon was proposed to be a triplet.
APPEARS IN
RELATED QUESTIONS
Describe the process of transcription in bacteria
How is Prokaryotic Transcription process different in eukaryotes?
Explain the processing the hnRNA needs to undergo before becoming functional mRNA in eukaryotes.
Explain the role of initiator tRNA in the initiation of protein synthesis.
What are introns?
Transcription is the transfer of genetic code from a DNA molecule to ______.
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
Reverse transcriptase is ______.
If the sequence of bases in DNA is ATTCGATG, then the sequence of bases in its transcript will be ______.
The process of copying genetic information from one strand of DNA to RNA is termed as ______.
Read the following and answer from given below:
The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.
Which ion is essential for the association of both units of the ribosome at the time of protein formation?
Which factor is important for termination of transcription?
In prokaryotes, where does transcription occur?
In eukaryotes, where does transcription occur?
What is the direction of the coding strand?
A transcription unit consists of how many major parts?
Which part of a transcription unit serves as the stop site for transcription?
What happens during the initiation stage of transcription?
What occurs during the elongation stage of transcription?
