Advertisements
Advertisements
प्रश्न
Explain the role of initiator tRNA in the initiation of protein synthesis.
Advertisements
उत्तर
Initiator tRNA carries amino acid methionine at its amino acid binding site and has anticodon UCA at its anticodon binding site. Initiator tRNA binds with the codon (AUG) present on the mRNA and in this way the initiator tRNA plays a role in the initiation of protein synthesis.
APPEARS IN
संबंधित प्रश्न
Following are the features of genetic codes. What does each one indicate?
Stop codon; Unambiguous codon; Degenerate codon; Universal codon.
- Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides.
- Explain the basis on which he arrived at this conclusion.
Explain the processing the hnRNA needs to undergo before becoming functional mRNA in eukaryotes.
A mRNA molecule is produced by ______.
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
Which is not involved in protein synthesis?
If the sequence of bases in DNA is ATTCGATG, then the sequence of bases in its transcript will be ______.
In a cell, DNA transcription is halted when ______
Read the following and answer from given below:
The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.
Which ion is essential for the association of both units of the ribosome at the time of protein formation?
Which enzyme is responsible for catalyzing the transcription process?
