Advertisements
Advertisements
Questions
Draw neat and labelled diagram of Replication Fork.
Draw a labelled schematic sketch of replication fork of DNA.
Advertisements
Solution 1
Solution 2
RELATED QUESTIONS
Very Short Answer Question:
Why are Okazaki fragments formed on lagging strand only?
Very Short Answer Question:
When does DNA replication takes place?
Long Answer Question:
Explain the process of DNA replication.
Semiconservative mechanism of DNA was detected using:
What is the basis for the difference in the synthesis of the leading and lagging strand of DNA molecules?
Which of the following statements is not true about DNA replication in eukaryotes?
Identify the direction of DNA replication in eukaryotes.
DNA replication begins at specific sites situated on the molecule. Such sites are called ____________.
Match Column I with Column II and select the correct option among the following.
| Column I | Column II | ||
| i. | DNA replication | a. | RNA polymerase |
| ii. | Translation | b. | DNA polymerase |
| iii. | Transcription | c. | Reverse transcriptase |
| iv. | Reverse transcription | d. | t-RNA- amino acid complex |
______ heavy isotope was used by Meselson and Stahl during their experiment.
Which one of the following correctly represents the manner of replication of DNA?
The addition of nucleotides on the lagging strand occurs ____________ during DNA replication.
Select the mis-matched pair.
Okazaki segments are formed during ______.
Characteristics unique to DNA are ______.
Select the incorrect statement regarding DNA replication.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
In prokaryotes, the primers of lagging strands are removed by ______.
In eukaryotic organisms, replication of DNA occurs in ______.
Statement I - In prokaryotes, there is only replicon however in eukaryotes, these are several replicons in tandem.
Statement II - Two separated strands in a replicon of DNA are prevented from re-joining by helicase enzyme.
In light of above statements, choose the correct answer from the option given below.
