Advertisements
Advertisements
Questions
Draw neat and labelled diagram of Replication Fork.
Draw a labelled schematic sketch of replication fork of DNA.
Advertisements
Solution 1
Solution 2
RELATED QUESTIONS
Which enzyme does remove supercoils from replicating DNA?
During DNA replication, the separated strands of DNA are prevented from recoiling by
What is the function of SSBP?
How Meselson and Stahl explained the concept of Semiconservative Replication of DNA experimentally?
Complementary strands of DNA molecule are (i) and bound by (ii).
Which of the following technique was used by Meselson and Stahl to demonstrate the semiconservative mode of DNA replication?
Which of the following represents the autocatalytic functions of DNA?
Enzyme ______ brings about the DNA unwinding by breaking weak hydrogen bonds in the vicinity of origin.
Assertion (A): DNA replication is said to be semi-conservative.
Reason (R): After DNA replication, each daughter molecule has one old and one new strand.
Which of the following term correctly describes the movement of ribosome on the mRNA?
Which of the following is present at the sticky ends of a fragmented DNA molecule?
______ carbon atoms of successive nucleotides of nucleic acid are linked by Phospho-diester bond.
Extension of the plasma membrane in a prokaryotic cell is ______.
Okazaki is known for his contribution to the under tanding of:
What background information did Watson and Crick had available with them for developing a model of DNA? What was their own contribution?
Select the incorrect statement regarding DNA replication.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
Enzyme involved in synthesis of RNA primer.
