Advertisements
Advertisements
Question
Long Answer Question:
Explain the process of DNA replication.
Advertisements
Solution
The process by which DNA duplicates to form identical copies is known as replication.
Semi-conservative method of replication:
1. After replication, each daughter DNA molecule has one old and other new strands.
2. As parental DNA is partly conserved in each daughter's DNA, the process of replication is called semi-conservative.
3. The model of semi-conservative replication was proposed by Watson and Crick.
4. The semi-conservative model of DNA replication using the heavy isotope of nitrogen N15 and E. coli was experimentally proved by Meselson and Stahl (1958).
Mechanism of replication is as follows:
a. Activation of Nucleotides:
i. The four types of nucleotides of DNA i.e. dAMP, dGMP, dCMP and dTMP are present in the nucleoplasm.
ii. They are activated by ATP in presence of an enzyme phosphorylase.
iii. This results in the formation of deoxyribonucleotide triphosphates i.e. dATP, dGTP, dCTP and dTTP. This process is known as Phosphorylation.
b. Point of Origin or Initiation point:
i. Replication begins at a specific point ‘O’ origin and terminates at point ‘T’.
ii. Origin is flanked by ‘T’ sites. The unit of DNA in which replication occurs is called replicon.
iii. In prokaryotes, there is only one replicon however in eukaryotes, there are several replicons in tandem.
iv. At the point ‘O’, enzyme endonuclease nicks one of the strands of DNA, temporarily.
v. The nick occurs in the sugar-phosphate backbone or the phosphodiester bond.
c. Unwinding of DNA molecule:
i. Enzyme DNA helicase breaks weak hydrogen bonds in the vicinity of ‘O’.
ii. The strands of DNA separate and unwind. This unwinding is bidirectional and continues as ‘Y’ shaped replication fork.
iii. Each separated strand acts as a template.
iv. The two separated strands are prevented from recoiling (rejoining) by SSBP (Single-strand binding proteins).
v. SSB proteins remain attached to both the separated strands for facilitating the synthesis of new polynucleotide strands.
d. Replicating fork:
i. The point formed due to the unwinding and separation of two strands appears like a Y-shaped fork, called replicating/ replication fork.
ii. The unwinding of strands imposes strain which is relieved by the super-helix relaxing enzyme.
e. Synthesis of new strands:
i. Each separated strand acts as a mould or template for the synthesis of a new complementary strand.
ii. It requires a small RNA molecule, called RNA primer.
iii. RNA primer attaches to the 3’ end of the template strand and attracts complementary nucleotides from the surrounding nucleoplasm.
iv. These nucleotides bind to the complementary nucleotides on the template strand by forming hydrogen bonds (i.e. A=T or T=A; G = C or C = G).
v. The newly bound consecutive nucleotides get interconnected by phosphodiester bonds, forming a polynucleotide strand.
vi. The synthesis of a new complementary strand is catalyzed by enzyme DNA polymerase. 7. The new complementary strand is always formed in 5’→ 3’ direction.
f. Leading and Lagging strand:
i. The template strand with free 3’ end is called a leading template and with free 5’ end is called a lagging template.
ii. The process of replication always starts at the C-3 end of the template strand and proceeds towards C-5 end.
iii. As both the strands of the parental DNA are antiparallel, new strands are always formed in 5’ → 3’ direction.
iv. One of the newly synthesized strands which develop continuously towards the replicating fork is called the leading strand.
v. Another new strand develops discontinuously away from the replicating fork and is called the lagging strand.
vi. Maturation of Okazaki fragments: DNA synthesis on the lagging template takes place in the form of small fragments called as Okazaki fragments (named after scientist Okazaki).
vii. Okazaki fragments are joined by the enzyme DNA ligase.
viii. RNA primers are removed by DNA polymerase and replaced by DNA sequence with the help of DNA polymerase-I in prokaryotes and DNA polymerase-α in eukaryotes.
ix. Finally, DNA gyrase (topoisomerase) enzyme forms a double helix to form daughter DNA molecules.
g. Formation of daughter DNA molecules:
i. At the end of the replication, two daughter DNA molecules are formed.
ii. In each daughter's DNA, one strand is parental and the other one is totally newly synthesized.
iii. Thus, 50% is contributed by mother DNA. Hence, it is described as semiconservative replication.

APPEARS IN
RELATED QUESTIONS
Which of the following statements about DNA replication is not correct?
Which of the following statements is not true about DNA replication in eukaryotes?
Meselson and Stahl’s experiment proved ______.
Identify the direction of DNA replication in eukaryotes.
Read the following statements and select the correct option.
i. The unit of DNA in which replication occurs, is called replicon.
ii. In eukaryotes, there is only one replicon however in prokaryotes there are several replicons in tandem.
Which of the following represents the autocatalytic functions of DNA?
Which of the following statement is incorrect?
During the replication of DNA, the separated strands are prevented from recoiling by using ______.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
The sequence of nitrogenous bases on DNA molecule is ATCGA. Which of the following is the correct complementary sequence of nitrogenous bases on mRNA molecule?
