Advertisements
Advertisements
प्रश्न
What is the function of an RNA primer during protein synthesis?
Advertisements
उत्तर
An RNA primer has no role in protein synthesis; it is used in DNA replication to initiate DNA synthesis by providing a starting point for DNA polymerase.
Function: The RNA primer binds to the template DNA strand, allowing DNA polymerase to add DNA nucleotides to the 3’ end of the primer. DNA nucleotides later replace this primer to complete the newly synthesized DNA strand.
APPEARS IN
संबंधित प्रश्न
Explain replication of bacteriophage with the help of a suitable diagram.
Define Heterochromatin.
Which of the following statements about DNA replication is not correct?
______ heavy isotope was used by Meselson and Stahl during their experiment.
Which one of the following correctly represents the manner of replication of DNA?
For which of the following reason RNA primer is must for initiation of DNA replication?
Which of the following is present at the sticky ends of a fragmented DNA molecule?
Which of the following is the function of single-strand binding proteins?
In a segment of DNA with 10 base pairs, the numbers of sugar molecules are _________.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
