Advertisements
Advertisements
प्रश्न
The nucleic acid synthesis takes place in ______.
पर्याय
3' - 5' direction
5’-3’ direction
Both ways
Any direction
Advertisements
उत्तर
The nucleic acid synthesis takes place in 5' - 3' direction.
APPEARS IN
संबंधित प्रश्न
When DNA directs the synthesis of chemical molecules other than itself, then such functions of DNA are known as ______.
Which of the following technique was used by Meselson and Stahl to demonstrate the semiconservative mode of DNA replication?
Enzyme ______ brings about the DNA unwinding by breaking weak hydrogen bonds in the vicinity of origin.
When the DNA molecule appears like inverted Y, it is ______
Match the following column.
| Column - I | Column - II |
| (A) DNA structure | 1. Muller and stadder |
| (B) Semiconservative replication of DNA | 2. Beadle and partum |
| (C) One gene-one enzyme theory | 3. Watson and crick |
| (D) Induction of mutation | 4. Massillon and stahl |
Okazaki segments are formed during ______.
Characteristics unique to DNA are ______.
Select the incorrect statement regarding DNA replication.
Draw a suitable diagram of replication of eukaryotic DNA and label any three parts.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
