Advertisements
Advertisements
प्रश्न
As the base sequence present on one strand of DNA decides the base sequence of other strands; this strand is considered as ______.
पर्याय
Descending strand
Leading strand
Lagging strand
Complimentary strand
Advertisements
उत्तर
As the base sequence present on one strand of DNA decides the base sequence of other strands; this strand is considered as Complimentary strand.
APPEARS IN
संबंधित प्रश्न
Explain replication of bacteriophage with the help of a suitable diagram.
Which enzyme does remove supercoils from replicating DNA?
E. coli, in which both the strands of DNA are labeled with 15N is transferred to 14N medium and allowed to replicate for three generations. What would be the number of hybrid DNA molecules in the third generation?
Which of the following represents the autocatalytic functions of DNA?
Which of the following statement is incorrect?
Wobble position means:
Okazaki is known for his contribution to the under tanding of:
Identify the biomolecule that is capable of self-replication.
The nucleic acid synthesis takes place in ______.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
