Advertisements
Advertisements
प्रश्न
As the base sequence present on one strand of DNA decides the base sequence of other strands; this strand is considered as ______.
विकल्प
Descending strand
Leading strand
Lagging strand
Complimentary strand
Advertisements
उत्तर
As the base sequence present on one strand of DNA decides the base sequence of other strands; this strand is considered as Complimentary strand.
APPEARS IN
संबंधित प्रश्न
Explain replication of bacteriophage with the help of a suitable diagram.
During DNA replication, the separated strands of DNA are prevented from recoiling by
A DNA segment has 75 cytosine and 40 thymine nucleotides. What shall be the total number of phosphates in the DNA segment?
Describe the process of semiconservative replication of DNA with the help of a neat and labelled diagram.
Identify the direction of DNA replication in eukaryotes.
Assertion (A): DNA replication is said to be semi-conservative.
Reason (R): After DNA replication, each daughter molecule has one old and one new strand.
Which of the following term correctly describes the movement of ribosome on the mRNA?
Extension of the plasma membrane in a prokaryotic cell is ______.
Draw a suitable diagram of replication of eukaryotic DNA and label any three parts.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
