Advertisements
Advertisements
प्रश्न
As the base sequence present on one strand of DNA decides the base sequence of other strands; this strand is considered as ______.
विकल्प
Descending strand
Leading strand
Lagging strand
Complimentary strand
Advertisements
उत्तर
As the base sequence present on one strand of DNA decides the base sequence of other strands; this strand is considered as Complimentary strand.
APPEARS IN
संबंधित प्रश्न
Which enzyme does remove supercoils from replicating DNA?
Long Answer Question:
Explain the process of DNA replication.
DNA replication begins at specific sites situated on the molecule. Such sites are called ____________.
For which of the following purpose agarose gel electrophoresis technique is used?
Which one of the following correctly represents the manner of replication of DNA?
Identify the CORRECT combination of statements with respect to DNA synthesis.
I. Always the direction of DNA polymerization 5' → 3' when referring to the polarity of strand being synthesized.
II. DNA ligase forms hydrogen bonds between two newly synthesized DNA strands.
III. DNA polymerases on their own cannot initiate the process of replication.
IV. DNA polymerase can catalyse polymerization in both 5'→ 3' and 3'→ 5' direction.
Which of the following term correctly describes the movement of ribosome on the mRNA?
Which one of the following can form a nucleotide of DNA?
Identify the biomolecule that is capable of self-replication.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
