मराठी

E. coli cell grown on 15N medium are transferred to 14N medium and allowed to grow for two generations. DNA extracted from these cells is ultracentrifuged in a cesium chloride density gradient.

Advertisements
Advertisements

प्रश्न

E. coli cell grown on 15N medium are transferred to 14N medium and allowed to grow for two generations. DNA extracted from these cells is ultracentrifuged in a cesium chloride density gradient. What density distribution of DNA would you expect in this experiment?

पर्याय

  • One high and one low density band.

  • One intermediate density band.

  • One high and one intermediate density band.

  • One low and one intermediate density band.

MCQ
Advertisements

उत्तर

One low and one intermediate density band.

Explanation:

This experiment follows the Meselson-Stahl model of semi-conservative replication. When E. coli cells grown in heavy 15N are moved to light 14N, the first generation produces “hybrid” DNA molecules containing one heavy and one light strand, resulting in a single intermediate density band. In the second generation, these hybrid strands serve as templates; the heavy strands again produce hybrids, while the light strands pair with new 14N to form entirely “light” DNA. This results in two distinct bands: one intermediate (hybrid) and one low-density (light), proving that DNA replicates by keeping one old strand and synthesising one new one.

shaalaa.com
  या प्रश्नात किंवा उत्तरात काही त्रुटी आहे का?
पाठ 5: Molecular Genetics - Evaluation [पृष्ठ ८४]

APPEARS IN

सामाचीर कलवी Biology (Zoology) [English] Class 12 TN Board
पाठ 5 Molecular Genetics
Evaluation | Q 5. | पृष्ठ ८४
सामाचीर कलवी Biology (Zoology) [English] Class 12 TN Board
पाठ 5 Molecular Genetics
Evaluation | Q 5. | पृष्ठ ८७
नूतन Biology [English] Class 12 ISC
पाठ 5 Molecular Basis of Inheritance
TEST YOUR PROGRESS | Q 1. 27. | पृष्ठ २६४

संबंधित प्रश्‍न

What is the correct sequence of the stages in bacteriophage lytic cycle?

(A) Attachment, Penetration, Lysis, Multiplication

(B) Attachment, Penetration, Multiplication, Lysis

(C) Lysis, Penetration, Multiplication, Attachment

(D) Attachment, Lysis, Multiplication, Penetration


Explain the semi-conservative replication of eukaryotic DNA.


Long Answer Question:

Explain the process of DNA replication.


During DNA replication, the separated strands of DNA are prevented from recoiling by


What is the function of SSBP?


Draw neat and labelled diagram of Replication Fork.


What are Okazaki fragments?


Meselson and Stahl’s experiment proved ______.


Identify the direction of DNA replication in eukaryotes.


Match Column I with Column II and select the correct option among the following.

  Column I   Column II
i. DNA replication a. RNA polymerase
ii. Translation b. DNA polymerase
iii. Transcription c. Reverse transcriptase
iv. Reverse transcription d. t-RNA- amino acid complex

E. coli, in which both the strands of DNA are labeled with 15N is transferred to 14N medium and allowed to replicate for three generations. What would be the number of hybrid DNA molecules in the third generation?


When DNA directs the synthesis of chemical molecules other than itself, then such functions of DNA are known as ______.


Which of tbe following is generally used for creating density gradient during centrifugation?


Which one of the following can form a nucleotide of DNA?


Which of the following statement is incorrect?


What background information did Watson and Crick had available with them for developing a model of DNA? What was their own contribution?


During the replication of DNA, the separated strands are prevented from recoiling by using ______.


Characteristics unique to DNA are ______.


How many amino acids will be there in the polypeptide chain formed on the following mRNA?

5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'


Enzyme involved in synthesis of RNA primer.


Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×