Advertisements
Advertisements
प्रश्न
What is the function of SSBP?
Advertisements
उत्तर
Single strand DNA binding proteins (SSBPs) are important during DNA synthesis as they prevent the coiling of the separated DNA strands.
APPEARS IN
संबंधित प्रश्न
Read the following statements and select the correct option.
i. The unit of DNA in which replication occurs, is called replicon.
ii. In eukaryotes, there is only one replicon however in prokaryotes there are several replicons in tandem.
E. coli, in which both the strands of DNA are labeled with 15N is transferred to 14N medium and allowed to replicate for three generations. What would be the number of hybrid DNA molecules in the third generation?
Assertion (A): DNA replication is said to be semi-conservative.
Reason (R): After DNA replication, each daughter molecule has one old and one new strand.
______ carbon atoms of successive nucleotides of nucleic acid are linked by Phospho-diester bond.
"DNA is considered as genetic material" - Why?
Extension of the plasma membrane in a prokaryotic cell is ______.
Which of the following statement is incorrect?
Okazaki segments are formed during ______.
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
Statement I - In prokaryotes, there is only replicon however in eukaryotes, these are several replicons in tandem.
Statement II - Two separated strands in a replicon of DNA are prevented from re-joining by helicase enzyme.
In light of above statements, choose the correct answer from the option given below.
