Advertisements
Advertisements
प्रश्न
What is the function of SSBP?
Advertisements
उत्तर
Single strand DNA binding proteins (SSBPs) are important during DNA synthesis as they prevent the coiling of the separated DNA strands.
APPEARS IN
संबंधित प्रश्न
Semiconservative mechanism of DNA was detected using:
During DNA replication, the separated strands of DNA are prevented from recoiling by
Meselson and Stahl’s experiment proved ______.
Identify the CORRECT combination of statements with respect to DNA synthesis.
I. Always the direction of DNA polymerization 5' → 3' when referring to the polarity of strand being synthesized.
II. DNA ligase forms hydrogen bonds between two newly synthesized DNA strands.
III. DNA polymerases on their own cannot initiate the process of replication.
IV. DNA polymerase can catalyse polymerization in both 5'→ 3' and 3'→ 5' direction.
Select the mis-matched pair.
When the DNA molecule appears like inverted Y, it is ______
In viral DNA, how many origins of replication is/are present?
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
Which of the following DNA polymerase enzyme in eukaryotes has 5' -3' exonuclease activity?
Which of the following statement is correct regarding the process of replication in E.coli?
