Advertisements
Advertisements
प्रश्न
What is the basis for the difference in the synthesis of the leading and lagging strand of DNA molecules?
विकल्प
Origin of replication occurs only at the 5’ end of the molecules.
DNA ligase works only in the 3’ → 5’ direction.
DNA polymerase can join new nucleotides only to the 3’ end of the growing strand.
Helicases and single-strand binding proteins that work at the 5’ end.
Advertisements
उत्तर
DNA polymerase can join new nucleotides only to the 3’ end of the growing strand.
Explanation:
The primary reason for the difference in synthesis is the directional constraint of the enzyme DNA polymerase, which can only add new nucleotides in the 3’ → 5’ direction. Because the two strands of the DNA double helix are antiparallel (running in opposite directions), only one strand, the leading strand, can be synthesised continuously as the replication fork opens. The other strand, known as the lagging strand, must be synthesised in short, discontinuous segments called Okazaki fragments because its template runs in a direction that forces the polymerase to move away from the expanding replication fork to find a free 3’ end.
APPEARS IN
संबंधित प्रश्न
As the base sequence present on one strand of DNA decides the base sequence of other strands; this strand is considered as ______.
Which enzyme does remove supercoils from replicating DNA?
Very Short Answer Question:
When does DNA replication takes place?
Enlist the names of enzymes used in semiconservative replication of DNA?
What is the function of SSBP?
Draw neat and labelled diagram of Replication Fork.
Which of the following technique was used by Meselson and Stahl to demonstrate the semiconservative mode of DNA replication?
Enzyme ______ brings about the DNA unwinding by breaking weak hydrogen bonds in the vicinity of origin.
Which of the following is the function of single-strand binding proteins?
The addition of nucleotides on the lagging strand occurs ____________ during DNA replication.
Which one of the following can form a nucleotide of DNA?
In DNA molecule, pairing between two complementary nucleotides takes place by ________ bonds.
Extension of the plasma membrane in a prokaryotic cell is ______.
Which of the following reaction is required for proofreading during DNA replication by DNA polymerase III?
In viral DNA, how many origins of replication is/are present?
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
In eukaryotic organisms, replication of DNA occurs in ______.
Statement I - In prokaryotes, there is only replicon however in eukaryotes, these are several replicons in tandem.
Statement II - Two separated strands in a replicon of DNA are prevented from re-joining by helicase enzyme.
In light of above statements, choose the correct answer from the option given below.
Which phase of the cell cycle is DNA replication primarily restricted to?
Which scientists first proposed the semi-conservative model of DNA replication based on the structure of the double helix?
