Advertisements
Advertisements
प्रश्न
______ enzymes are used as biological scissors in r-DNA technology.
विकल्प
Restriction endonucleases
DNA ligases
DNA polymerases
Reverse transcriptases
Advertisements
उत्तर
Restriction endonucleases enzymes are used as biological scissors in r-DNA technology.
APPEARS IN
संबंधित प्रश्न
How CO2 makes idlies puffy?
a) Identify the figure given below
b) Redraw the structure as a replicating fork and label the parts
c) Write the source of energy for this replication and name the enzyme involved in this process.
d) Mention the differences in the synthesis of protein, based on the polarity of the two template strands.
During DNA replication, Okazaki fragments are used to elongate ____________.
Assertion (A): DNA replication is said to be semi-conservative.
Reason (R): After DNA replication, each daughter molecule has one old and one new strand.
Identify the CORRECT combination of statements with respect to DNA synthesis.
I. Always the direction of DNA polymerization 5' → 3' when referring to the polarity of strand being synthesized.
II. DNA ligase forms hydrogen bonds between two newly synthesized DNA strands.
III. DNA polymerases on their own cannot initiate the process of replication.
IV. DNA polymerase can catalyse polymerization in both 5'→ 3' and 3'→ 5' direction.
Which of the following term correctly describes the movement of ribosome on the mRNA?
When the DNA molecule appears like inverted Y, it is ______
During replication of DNA Okazaki fragments are formed in the direction:
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
Torsional stress created during DNA replication is relieved by ______.
