Advertisements
Advertisements
प्रश्न
Which of the following is the correct sequence of event with reference to the central dogma?
विकल्प
Transcription, Translation, Replication
Transcription, Replication, Translation
Duplication, Translation, Transcription
Replication, Transcription, Translation
Advertisements
उत्तर
Replication, Transcription, Translation
Explanation:
The Central Dogma describes the fundamental flow of genetic information within a biological system, typically following a specific three-step sequence:
- Replication: The process by which DNA makes an exact copy of itself, ensuring genetic continuity during cell division.
- Transcription: The genetic code from a DNA template is used to synthesise a complementary messenger RNA (mRNA) molecule.
- Translation: The sequence of nucleotides in the mRNA is decoded at the ribosome to assemble amino acids into a specific protein.
APPEARS IN
संबंधित प्रश्न
Following are the features of genetic codes. What does each one indicate?
Stop codon; Unambiguous codon; Degenerate codon; Universal codon.
Describe the process of transcription in bacteria
Explain the process of transcription in prokaryotes.
- Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides.
- Explain the basis on which he arrived at this conclusion.
How is Prokaryotic Transcription process different in eukaryotes?
Explain the role of initiator tRNA in the initiation of protein synthesis.
What are introns?
Explain the mechanism of transcription in a prokaryotic cell.
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
Reverse transcriptase is ______.
Which is not involved in protein synthesis?
In a cell, DNA transcription is halted when ______
Read the following and answer from given below:
The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.
Which ion is essential for the association of both units of the ribosome at the time of protein formation?
The process of copying genetic information from one strand of the DNA into RNA is termed as ______
Match List I with List II.
| List I | List II |
| A. RNA polymerase III | I. snRNPs |
| B. Termination of transcription | II. Promotor |
| C. Splicing of Exons | III. Rho factor |
| D. TATA box | IV. SnRNAs, tRNA |
Choose the correct answer from the options given below:
In the processing of hnRNA in eukaryotic cell, the primary transcripts are processed in the following sequence.
