Advertisements
Advertisements
प्रश्न
Which of the following is the correct sequence of event with reference to the central dogma?
विकल्प
Transcription, Translation, Replication
Transcription, Replication, Translation
Duplication, Translation, Transcription
Replication, Transcription, Translation
Advertisements
उत्तर
Replication, Transcription, Translation
Explanation:
The Central Dogma describes the fundamental flow of genetic information within a biological system, typically following a specific three-step sequence:
- Replication: The process by which DNA makes an exact copy of itself, ensuring genetic continuity during cell division.
- Transcription: The genetic code from a DNA template is used to synthesise a complementary messenger RNA (mRNA) molecule.
- Translation: The sequence of nucleotides in the mRNA is decoded at the ribosome to assemble amino acids into a specific protein.
APPEARS IN
संबंधित प्रश्न
Following are the features of genetic codes. What does each one indicate?
Stop codon; Unambiguous codon; Degenerate codon; Universal codon.
Explain the process of transcription in prokaryotes.
Explain the processing the hnRNA needs to undergo before becoming functional mRNA in eukaryotes.
Explain the role of initiator tRNA in the initiation of protein synthesis.
What are introns?
Transcription is the transfer of genetic code from a DNA molecule to ______.
What is the central dogma?
Explain the mechanism of transcription in a prokaryotic cell.
Name the parts marked ‘A’ and ‘B’ in the given transcription unit:
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
The process of transfer of genetic information from DNA to RNA/formation of RNA from DNA is ______.
Reverse transcriptase is ______.
If the sequence of bases in DNA is ATTCGATG, then the sequence of bases in its transcript will be ______.
Read the following and answer from given below:
The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.
Which ion is essential for the association of both units of the ribosome at the time of protein formation?
The process of copying genetic information from one strand of the DNA into RNA is termed as ______
