हिंदी

A mRNA molecule is produced by ______.

Advertisements
Advertisements

प्रश्न

A mRNA molecule is produced by ______.

विकल्प

  • Replication

  • Transcription

  • Duplication

  • Translation

MCQ
रिक्त स्थान भरें
Advertisements

उत्तर

A mRNA molecule is produced by transcription.

Explanation:

mRNA is synthesised from a DNA template during transcription. RNA polymerase makes a complementary single-stranded mRNA from one DNA strand. Replication makes copies of DNA, duplication is not the standard term for mRNA synthesis, and translation uses mRNA to build proteins.

shaalaa.com
  क्या इस प्रश्न या उत्तर में कोई त्रुटि है?
अध्याय 5: Molecular Genetics - Evaluation [पृष्ठ ८४]

APPEARS IN

सामाचीर कलवी Biology (Zoology) [English] Class 12 TN Board
अध्याय 5 Molecular Genetics
Evaluation | Q 3. | पृष्ठ ८४
सामाचीर कलवी Biology (Zoology) [English] Class 12 TN Board
अध्याय 5 Molecular Genetics
Evaluation | Q 3. | पृष्ठ ८७
नूतन Biology [English] Class 12 ISC
अध्याय 5 Molecular Basis of Inheritance
TEST YOUR PROGRESS | Q 1. 16. | पृष्ठ २६३

वीडियो ट्यूटोरियलVIEW ALL [1]

संबंधित प्रश्न

Describe the process of transcription in bacteria


Explain the process of transcription in prokaryotes.


State the aim and describe Messelson and Stahl’s experiment.


Explain the processing the hnRNA needs to undergo before becoming functional mRNA in eukaryotes.


Explain the role of initiator tRNA in the initiation of protein synthesis.


Transcription is the transfer of genetic code from a DNA molecule to ______.


Initiation codon of protein synthesis in Eukaryotes is ______.


What is the central dogma?


Explain the mechanism of transcription in a prokaryotic cell.


If the coding sequence in a transcription unit is written as follows:

5' TGCATGCATGCATGCATGCATGCATGC 3'

Write down the sequence of mRNA.


If the sequence of bases in DNA is ATTCGATG, then the sequence of bases in its transcript will be ______.


Read the following and answer from given below:

The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.

Which ion is essential for the association of both units of the ribosome at the time of protein formation?


The process of copying genetic information from one strand of the DNA into RNA is termed as ______


Which factor is important for termination of transcription?


Match List I with List II.

List I List II
A. RNA polymerase III I. snRNPs
B. Termination of transcription II. Promotor
C. Splicing of Exons III. Rho factor
D. TATA box IV. SnRNAs, tRNA

Choose the correct answer from the options given below:


In the processing of hnRNA in eukaryotic cell, the primary transcripts are processed in the following sequence.


Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×