हिंदी

A mRNA molecule is produced by ______. - Biology (Theory)

Advertisements
Advertisements

प्रश्न

A mRNA molecule is produced by ______.

विकल्प

  • Replication

  • Transcription

  • Duplication

  • Translation

MCQ
रिक्त स्थान भरें
Advertisements

उत्तर

A mRNA molecule is produced by transcription.

Explanation:

mRNA is synthesised from a DNA template during transcription. RNA polymerase makes a complementary single-stranded mRNA from one DNA strand. Replication makes copies of DNA, duplication is not the standard term for mRNA synthesis, and translation uses mRNA to build proteins.

shaalaa.com
  क्या इस प्रश्न या उत्तर में कोई त्रुटि है?
अध्याय 5: Molecular Genetics - Evaluation [पृष्ठ ८४]

APPEARS IN

सामाचीर कलवी Biology (Zoology) [English] Class 12 TN Board
अध्याय 5 Molecular Genetics
Evaluation | Q 3. | पृष्ठ ८४
सामाचीर कलवी Biology (Zoology) [English] Class 12 TN Board
अध्याय 5 Molecular Genetics
Evaluation | Q 3. | पृष्ठ ८७
नूतन Biology [English] Class 12 ISC
अध्याय 6 Molecular Basis of Inheritance
Test Your Progress | Q 1. 16. | पृष्ठ २६३

वीडियो ट्यूटोरियलVIEW ALL [1]

संबंधित प्रश्न

Describe the process of transcription in bacteria


How do m-RNA, t-RNA and ribosomes help in the process of translation?


Explain the process of transcription in prokaryotes.


(i) Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides.
(ii) Explain the basis on which he arrived at this conclusion.


Name the enzyme responsible for the transcription of tRNA and the amino acid the initiator tRNA gets linked with.


State the aim and describe Messelson and Stahl’s experiment.


Briefly describe the following:

Transcription 


How is Prokaryotic Transcription process different in eukaryotes?


Explain the role of initiator tRNA in the initiation of protein synthesis.


What are introns?


Which of the following is the correct sequence of event with reference to the central dogma?


If the coding sequence in a transcription unit is written as follows:

5' TGCATGCATGCATGCATGCATGCATGC 3'

Write down the sequence of mRNA.


Reverse transcriptase is ______.


DNA template sequence of CTGATAGC is transcribed over mRNA as ______.


If the sequence of bases in DNA is ATTCGATG, then the sequence of bases in its transcript will be ______.


The process of copying genetic information from one strand of DNA to RNA is termed as ______.


In a cell, DNA transcription is halted when ______ 


Read the following and answer from given below:

The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.

Which ion is essential for the association of both units of the ribosome at the time of protein formation?


Share
Notifications

Englishहिंदीमराठी


      Forgot password?
Use app×