Advertisements
Advertisements
प्रश्न
A mRNA molecule is produced by ______.
विकल्प
Replication
Transcription
Duplication
Translation
Advertisements
उत्तर
A mRNA molecule is produced by transcription.
Explanation:
mRNA is synthesised from a DNA template during transcription. RNA polymerase makes a complementary single-stranded mRNA from one DNA strand. Replication makes copies of DNA, duplication is not the standard term for mRNA synthesis, and translation uses mRNA to build proteins.
APPEARS IN
संबंधित प्रश्न
Describe the process of transcription in bacteria
How do m-RNA, t-RNA and ribosomes help in the process of translation?
Explain the process of transcription in prokaryotes.
- Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides.
- Explain the basis on which he arrived at this conclusion.
Explain the processing the hnRNA needs to undergo before becoming functional mRNA in eukaryotes.
Explain the role of initiator tRNA in the initiation of protein synthesis.
Initiation codon of protein synthesis in Eukaryotes is ______.
Explain the mechanism of transcription in a prokaryotic cell.
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
DNA template sequence of CTGATAGC is transcribed over mRNA as ______.
If the sequence of bases in DNA is ATTCGATG, then the sequence of bases in its transcript will be ______.
The process of copying genetic information from one strand of DNA to RNA is termed as ______.
Read the following and answer from given below:
The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.
Which ion is essential for the association of both units of the ribosome at the time of protein formation?
Which factor is important for termination of transcription?
In the processing of hnRNA in eukaryotic cell, the primary transcripts are processed in the following sequence.
What is the direction of the template strand during transcription?
What occurs during the elongation stage of transcription?
Which three post-transcriptional modifications convert hnRNA into mature mRNA in eukaryotes?
