Advertisements
Advertisements
प्रश्न
Define Heterochromatin.
Advertisements
उत्तर
Heterochromatin is a genetically and transcriptionally inactive, condensed, and strongly staining region of chromosomes.
APPEARS IN
संबंधित प्रश्न
How CO2 makes idlies puffy?
As the base sequence present on one strand of DNA decides the base sequence of other strands; this strand is considered as ______.
Draw neat and labelled diagram of Replication Fork.
Which of the following statements is not true about DNA replication in eukaryotes?
For which of the following purpose agarose gel electrophoresis technique is used?
During DNA replication, Okazaki fragments are used to elongate ____________.
Which of the following technique was used by Meselson and Stahl to demonstrate the semiconservative mode of DNA replication?
During replication of DNA Okazaki fragments are formed in the direction:
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
The sequence of nitrogenous bases on DNA molecule is ATCGA. Which of the following is the correct complementary sequence of nitrogenous bases on mRNA molecule?
