Advertisements
Advertisements
प्रश्न
Name the enzyme responsible for the transcription of tRNA and the amino acid the initiator tRNA gets linked with.
Advertisements
उत्तर
RNA polymerase III is responsible for transcription of tRNA and methionine is the amino acid that gets linked with the initiator tRNA.
APPEARS IN
संबंधित प्रश्न
Following are the features of genetic codes. What does each one indicate?
Stop codon; Unambiguous codon; Degenerate codon; Universal codon.
Explain the processing the hnRNA needs to undergo before becoming functional mRNA in eukaryotes.
What are introns?
Transcription is the transfer of genetic code from a DNA molecule to ______.
What is the central dogma?
Which of the following is the correct sequence of event with reference to the central dogma?
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
How is the two stage process of protein synthesis advantageous?
In a cell, DNA transcription is halted when ______
Read the following and answer from given below:
The translation is the process of polymerization of amino acids to form a polypeptide. The order and sequence of amino acids are defined by the sequence bases in the mRNA. The amino acids are joined by a bond called a peptide bond. The ribosome is the site of protein synthesis.
Which ion is essential for the association of both units of the ribosome at the time of protein formation?
