Advertisements
Advertisements
प्रश्न
How is Prokaryotic Transcription process different in eukaryotes?
Advertisements
उत्तर
Differences between prokaryotic and eukaryotic transcription:
| Prokaryotic Transcription | Eukaryotic Transcription |
| 1. It occurs in the cytoplasm | 1. It occurs in the nucleus. |
| 2. There is no specific period for prokaryotic transcription to occur. | 2. It occurs in the G1 and G2 phases. |
| 3. Products of transcription become effective in situ. | 3. Transcription products come out of the nucleus for functioning in the cytoplasm. |
| 4. mRNA is generally polycistronic | 4. mRNA is generally monocistronic. |
APPEARS IN
संबंधित प्रश्न
- Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides.
- Explain the basis on which he arrived at this conclusion.
Initiation codon of protein synthesis in Eukaryotes is ______.
Explain the mechanism of transcription in a prokaryotic cell.
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
How is the two stage process of protein synthesis advantageous?
DNA template sequence of CTGATAGC is transcribed over mRNA as ______.
If the sequence of bases in DNA is ATTCGATG, then the sequence of bases in its transcript will be ______.
In the processing of hnRNA in eukaryotic cell, the primary transcripts are processed in the following sequence.
What is the direction of the template strand during transcription?
Which part of a transcription unit serves as the stop site for transcription?
