Advertisements
Advertisements
प्रश्न
How is Prokaryotic Transcription process different in eukaryotes?
Advertisements
उत्तर
Differences between prokaryotic and eukaryotic transcription:
| Prokaryotic Transcription | Eukaryotic Transcription |
| 1. It occurs in the cytoplasm | 1. It occurs in the nucleus. |
| 2. There is no specific period for prokaryotic transcription to occur. | 2. It occurs in the G1 and G2 phases. |
| 3. Products of transcription become effective in situ. | 3. Transcription products come out of the nucleus for functioning in the cytoplasm. |
| 4. mRNA is generally polycistronic | 4. mRNA is generally monocistronic. |
APPEARS IN
संबंधित प्रश्न
Following are the features of genetic codes. What does each one indicate?
Stop codon; Unambiguous codon; Degenerate codon; Universal codon.
How do m-RNA, t-RNA and ribosomes help in the process of translation?
What are introns?
What is the central dogma?
Explain the mechanism of transcription in a prokaryotic cell.
A mRNA molecule is produced by ______.
Name the parts marked ‘A’ and ‘B’ in the given transcription unit:
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
DNA template sequence of CTGATAGC is transcribed over mRNA as ______.
If the sequence of bases in DNA is ATTCGATG, then the sequence of bases in its transcript will be ______.
