Advertisements
Advertisements
प्रश्न
How is Prokaryotic Transcription process different in eukaryotes?
Advertisements
उत्तर
Differences between prokaryotic and eukaryotic transcription:
| Prokaryotic Transcription | Eukaryotic Transcription |
| 1. It occurs in the cytoplasm | 1. It occurs in the nucleus. |
| 2. There is no specific period for prokaryotic transcription to occur. | 2. It occurs in the G1 and G2 phases. |
| 3. Products of transcription become effective in situ. | 3. Transcription products come out of the nucleus for functioning in the cytoplasm. |
| 4. mRNA is generally polycistronic | 4. mRNA is generally monocistronic. |
APPEARS IN
संबंधित प्रश्न
How do m-RNA, t-RNA and ribosomes help in the process of translation?
Explain the role of initiator tRNA in the initiation of protein synthesis.
Initiation codon of protein synthesis in Eukaryotes is ______.
Explain the mechanism of transcription in a prokaryotic cell.
A mRNA molecule is produced by ______.
If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
How is the two stage process of protein synthesis advantageous?
The process of transfer of genetic information from DNA to RNA/formation of RNA from DNA is ______.
The process of copying genetic information from one strand of DNA to RNA is termed as ______.
Which factor is important for termination of transcription?
