Please select a subject first
Advertisements
Advertisements
Short Answer Question:
Write a note on Human genome project (HGP).
Concept: Human Genome Project
Find the odd one out:
Concept: Packaging of DNA Helix
What happened when heat-killed S-cells along with living R-cells were injected into mice?
Concept: Deoxyribonucleic Acid (DNA)
Semiconservative mechanism of DNA was detected using:
Concept: DNA Replication
What is the role of Mg++ in Translation?
Concept: Protein Synthesis
Enlist the names of enzymes used in semiconservative replication of DNA?
Concept: DNA Replication
Differentiate between Heterochromatin & Euchromatin.
Concept: Packaging of DNA Helix
Draw a neat and labelled diagram of the Nucleosome.
Concept: Packaging of DNA Helix
Draw neat and labelled diagram of Replication Fork.
Concept: DNA Replication
Draw a neat and labelled diagram of transcription and processing of hn-RNA
Concept: Protein Synthesis
How Meselson and Stahl explained the concept of Semiconservative Replication of DNA experimentally?
Concept: DNA Replication
Histones are rich in ______.
Concept: Packaging of DNA Helix
During the replication of DNA, the separated strands are prevented from recoiling by using ______.
Concept: DNA Replication
Write the aims of the human genome project.
Concept: Human Genome Project
The nucleic acid synthesis takes place in ______.
Concept: DNA Replication
Describe the process of transcription.
Concept: Protein Synthesis
Distinguish between heterochromatin and euchromatin with reference to staining property and activity.
Concept: Packaging of DNA Helix
Draw a suitable diagram of replication of eukaryotic DNA and label any three parts.
Concept: DNA Replication
How many amino acids will be there in the polypeptide chain formed on the following mRNA?
5'GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
Concept: DNA Replication
Give the different steps involved in formation of m-RNA from hn-RNA.
Concept: Protein Synthesis
